a pegylated anti tumour necrosis factor alpha biological agent

... of autoantibodies were an indirect immunofluorescent assay for ANA, an ELISA or Farr assay for anti- DNA antibodies, Ouchterlony's method for anti- extractable nuclear antigens (anti- ENA), and an ... ELISA for anti- histone, anti- Ro, anti- La, anti- SM, anti- RNP, anti- JO1, anti- Topo 1, and anticardiolipin antibodies (ACL) Methods Between June and October 2003, the 'Club Rhumatismes et Inflammation', ... three patients treated with etanercept ANA, antinuclear antibodies; dsDNA, double-strand DNA; ENA, positive anti- extractable nuclear antigensantibodies We report on 22 patients treated with anti- TNF...

Ngày tải lên: 09/08/2014, 06:22

... van den Berg WB: Anticytokine treatment of established type II collagen-induced arthritis in DBA/1 mice A comparative study using anti- TNF alpha, anti- IL-1 alpha/ beta, and IL-1Ra Arthritis Rheum ... previously To facilitate cloning, the sense and anti- sense oligonucleotides of sequences GATCTTAAGCCATACCCGGGATCGGGATCCGACTTGG and TCGACCAAGTCGGATCCCGATCCCGGGTATGGCTTAA, respectively, containing restriction ... transcriptional activators: novel mutations yield expanded range and sensitivity Proc Natl Acad Sci USA 2000, 97:7963-7968 Salucci V, Scarito A, Aurisicchio L, Lamartina S, Nicolaus G, Giampaoli S, Gonzalez-Paz...

Ngày tải lên: 09/08/2014, 10:20

... five (apremilast) or two (rolipram) donors are plotted As a positive control, cells were treated with a combination of anti- TNFα mAb and IL-1RA Statistical analysis was calculated by one-way analysis ... (S)-N-[2-[1-(3-ethoxy-4-methoxyphenyl)-2methanesulfonylethyl]-1,3-dioxo-2,3-dihydro-1H-isoindol-4-yl] acetamide (apremilast), a potent and orally active phosphodiesterase and tumor necrosis factor- alpha inhibitor J Med Chem 2009, 52:1522-1524 18 Schafer PH, Parton A, Gandhi AK, Capone L, Adams ... treated orally with apremilast, dexamethasone or vehicle and disease severity was evaluated and assigned a clinical score (b) Area under the curve for each mouse was calculated and statistical significance...

Ngày tải lên: 12/08/2014, 14:22

... inefficacy and adverse events Variable Overall withdrawal Withdrawal due to inefficacy Withdrawal due to adverse events Univariate analysis Multivariate analysis Univariate analysis Multivariate analysis ... anti- tumor necrosis factor alpha agent to a second anti- tumor necrosis factor alpha agent in patients with rheumatoid arthritis: results from a large UK national cohort study Arthritis Rheum 2007, ... not affect these results There was also a worldwide shortage of etanercept during the early years, and adalimumab was marketed later than infliximab and etanercept As other drugs became available,...

Ngày tải lên: 09/08/2014, 14:20

... with etanercept [6] It is still unclear what effects anti- TNF treatment can have on B cells in RA and whether any effects influence the efficacy of these agents In patients with RA, anti- TNF agents ... neogenesis and its reversal after antitumour necrosis factor α therapy in rheumatoid arthritis Ann Rheum Dis 2009, 68:751-756 11 Weller S, Braun MC, Tan BK, Rosenwald A, Cordier C, Conley ME, Plebani A, ... (etanercept) and the monoclonal anti- TNF antibodies (infliximab and adalimumab), could have any consequence on the effect of these agents on B-cell homeostasis or function is not known The main...

Ngày tải lên: 09/08/2014, 14:22

... TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; ... 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: ... Elnekave E, Mentink-Kane MM, Hodges MG, Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A et al (2007) IL-13Ralpha2 and IL-10 coordinately suppress airway inflammation, airway-hyperreactivity,...

Ngày tải lên: 18/02/2014, 04:20

... cleavage of the 116 kDa caspase substrate poly(ADP-ribose) polymerase (PARP) to produce its characteristic 89-kDa cleavage product The results in Fig show that TRAIL alone induced partial cleavage ... increased apoptosis seen in response to IFNa plus TRAIL is characterized by elevated caspase-8 and caspase-9 activity, with enhanced degradation of BID and translocation of Bax to mitochondria [15], ... obtained from Trevigen (Gaithersburg, MD, USA) Antibodies against 4E-BP1 and a- tubulin were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and Sigma, respectively Monoclonal antibodies...

Ngày tải lên: 19/02/2014, 06:20

... (Biorad Laboratories) Densitometric analysis Each band, when mentioned, was analysed by alpha digidoc 1201 software (Alpha Innotech Corporation, San Leandro, CA, USA) The same sized rectangular ... 5¢-ATGAGTCTGGTTACTACAGCCA-3¢; antisense, 5¢AAGACAGGGCCGTCATTATGG-3¢) All reactions were performed in triplicate and expression levels were normalized to those of 18S rRNA Real-time PCR for quantification ... rRNA was taken as the internal loading control (A) Each band was analysed densitometrically and the values are depicted after normalization of PEPCK and G6Pase bands with those of 18S rRNA (B)...

Ngày tải lên: 16/03/2014, 02:20

... GGCATGGACTGTGGTCATGA ATAATTGGCAACCAGAACGCCAGG CCACATGGCTCTTGGTCATTTGCT CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC TGCAATAACCCATTTCCCTGGTGC TAGGAACGGATCCACCCAAACACT TTGTCAGCACACAGCGTTCACAAG AGGCTGCTTTGATGTCTTCGGTTG ... TNF via FXR1 22 Dean JL, Wait R, Mahtani KR, Sully G, Clark AR & Saklatvala J (2001) The 3¢ untranslated region of tumor necrosis factor alpha mRNA is a target of the mRNAstabilizing factor HuR ... 5¢-GAA GUU GAU AAA U-3¢ GCU UAU GUC CAG Statistical analysis Results are expressed as mean ± standard error of the mean The Mann–Whitney U-test, two-tailed, was used to determine significance Acknowledgements...

Ngày tải lên: 22/03/2014, 21:21

... JA, Graham DI, Dewar D: Nucleus basalis of Meynert pathology in the human brain after fatal head injury J Neurotrauma 2002, 19:279-84 Macdonald NJ, Taglialatela G: Tumor necrosis factor alpha ... visualized and quantified using a Becton Dickinson FACS Vantage Flow Cytometer set at appropriate instrument parameters Statistical analysis Where appropriate, data were expressed as mean +/standard ... rat iNOS were as follows; forward 5'-CAC GGA GAA CAG AGT TGG-3' and reverse 5'-GGA ACA CAG TAA TGG CCG ACC-3' Amplified samples were run on agarose gels and stained with ethidium bromide Images...

Ngày tải lên: 19/06/2014, 22:20

... and data segments were used Data are expressed as means ± standard error of the mean (SEM) Some data were normalized as a percentage of the control values (100%) Paired t-test, one-way ANOVA or ... display rapid activation and inactivation [31, 33] It was suggested that the increased recovery rates from inactivation of Nav 1.3 channels expressed along the axon after axotomy compared to Nav ... Modulation of spinal cord synaptic activity by tumor necrosis factor α in a model of peripheral neuropathy Diana Spicarova, Vladimir Nerandzic and Jiri Palecek Department of Functional Morphology,...

Ngày tải lên: 19/06/2014, 22:20

... LA, Helsen MM, van de Loo FA, van den Berg WB: Anticytokine treatment of established type II collagen-induced arthritis in DBA/1 mice A comparative study using anti- TNF alpha, anti- IL-1 alpha/ beta, ... Treatment was administered after onset of clinical arthritis All treated animals are illustrated in panels a and b; those with a clinical score of or less at the time of DNA injection (day 27) are ... year [10] Plasmid DNA also has the advantage of being very stable and both easy and cheap to produce in large quantities R104 Ideally, gene therapy for a chronic disease such as RA will permit...

Ngày tải lên: 09/08/2014, 01:23

... using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense ... (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG (sense) and GGTCCACCACCCTGTTGCTGTAGCC (antisense) as primers Reverse transcription PCR was carried out using an ... Haas M, Page S, Page M, Neumann FJ, Marx N, Adam M, ZieglarHeitbrock HW, Neumeier D, Brand K: Effect of proteasome inhibitors on monocytic IkappaB -alpha and -beta depletion, NF-kappaB activation,...

Ngày tải lên: 09/08/2014, 07:20

... Vigna-Pérez M, Abud-Mendoza C, Portillo-Salazar H, AlvaradoSánchez B, Cuevas-Orta E, Moreno-Valdés R, Baranda L, Paredes-Saharopulos O, González-Amaro R: Immune effects of therapy with Adalimumab ... (TNF) antagonists such as the antiTNF monoclonal antibodies (mAbs) infliximab (Ifx) and adalimumab (Ada) and the soluble TNF receptor etanercept (Eta) are efficacious in several immune-mediated ... Udagawa T, Kazumi Y, Sekikawa K, Sugawara I: Role of tumor necrosis factor- alpha in Mycobacterium-induced granuloma formation in tumor necrosis factoralpha-deficient mice Lab Invest 1999, 79:379-386...

Ngày tải lên: 09/08/2014, 08:22

... outcomes have been obtained with bisphonates via their anti- osteoclastic effect and anti- inflammatory action, which are related to their suppressive effect on tumor necrosis factor- alpha (TNF -a) [2] ... was the pathologist and performed the histological examinations All authors read and approved the final manuscript References Chamot AM, Benhamou CL, Kahn MF, Beraneck L, Kaplan G, Prost A: Acne-pustulosis-hyperostosis-osteitis ... Trotta F: In SAPHO syndrome antiTNF -alpha therapy may induce persistent amelioration of osteoarticular complaints, but may exacerbate cutaneous manifestations Rheumatology 2006, 45:730-733 Iqbal...

Ngày tải lên: 11/08/2014, 14:21

... infliximab; ETA, etanercept; ADA, adalimumab; HLA-B27+, human leukocyte antigen B27 positive; IBD, inflammatory bowel disease; NSAID, non-steroidal anti- inflammatory drug; DMARD, disease-modifying antirheumatic ... infliximab (n = 7) or adalimumab (n = 14) treatment due to inefficacy Antibody data were missing for one adalimumab patient Antibodies against infliximab and adalimumab were detected in of (71%) and ... trials (RCTs) have demonstrated that the tumor necrosis factor alpha (TNF -a) blocking agents infliximab, etanercept, and adalimumab are effective in the treatment of Ankylosing Spondylitis (AS)...

Ngày tải lên: 12/08/2014, 17:21

... Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor- alpha antagonism Kyle D Allen1,2, Mohammed F Shamji1,3, Brian A Mata2, ... evaluated for spatiotemporal gait characteristics and mechanical sensitivity On day 6, animals were evaluated for dynamic gait characteristics and weight bearing Animals were sacrificed on day ... in a custom-built gait arena (5’6” x 1’6”) preoperatively and again on day The arena is composed of a glass floor, three transparent acrylic sides, a black acrylic back, black acrylic top, and...

Ngày tải lên: 12/08/2014, 17:22

... is AJCC/UICC (Table 1.1) Traditionally, Ta and T1 papillary urothelial carcinoma are called superficial cancer and T2 and above are termed as muscle invasive cancer Table1.1: Pathological staging ... (Promega, Madison, WI) 2.1.3 Antibodies FITC anti- mouse CD3 (BD PharMingen,USA) Hamster anti- mouse B7-1 mAb (BD Pharmingen,USA) Hamster anti- mouse ICAM I mAb (BD Pharmingen,USA) Hamster anti- mouse ... Inactivation Inactivation Inactivation Inactivation Over activation Over activation Over activation Over activation The transfer of retinoblastoma (Rb) is also a common target for gene therapy...

Ngày tải lên: 08/11/2015, 16:45

... rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢ A negative control adenovirus vector containing nonspecific siRNA was constructed in the same way (nonspecific vector, 5¢-TTCTCCGAACGTGTCACGT-3¢) All vectors ... opens, apoptogenic substrates (i.e cytochrome c) are released into the cytoplasm and activate caspase-dependent apoptotic pathways Because MPTP plays a critical role in cell necrosis and apoptosis, ... viability and cell death after TRAP1-siRNA infection (Fig 6A, B) * 20 MPTP mediates the TRAP1 effect 10 TRAP1 is a mitochondria chaperon and plays a role in maintaining mitochondrial homeostasis,...

Ngày tải lên: 16/02/2014, 14:20

... anti- caspase-7, anti- actin, anti- DR4, anti- DR5, anti- DcR-2, anti- Bid, antiBax (Santa Cruz Biotech Inc., Santa Cruz, CA, USA), anti- caspase-9 (Immunotech), anti- caspase-3/CPP32 (BD Biosciences) and ... TCCTTAGGACATGGCAGAG-3¢; DcR2 forward, 5¢-CGGAATTCCGCGGAAGAAATTCATTTCT-3¢; DcR2 reverse, 5¢-CGGGATCCTCACAGGCAGGACG TAGCAG-3¢; Bax forward, 5¢-GCGAATTCCATGG ACGGGTCCGGGGAG-3¢; Bax reverse, 5¢-CGCTC GAGTCAGCCCATCTTCTTCCAG-3¢; ... are as follows: DR4 forward, 5¢-CGGAATTCGGAGGGGACCCCAAGTGCAT-3¢; DR4 reverse, 5¢-CGGGATCCTCACTCCAAGGACA CGGCA-3¢; DR5 forward, 5¢-CGGAATTCTGCA AGTCTTTACTGTGGAA-3¢; DR5 reverse, 5¢-CGGA TCCTTAGGACATGGCAGAG-3¢;...

Ngày tải lên: 23/03/2014, 17:22