a ok 323 03 decreased on passage

... attached to T7 promoter sequences for additional length The primers were 5'-AATACGACTCACTATAAGCAAAAGCAGG, complementary to the 3' end of viral RNA and 5'-CGGAATTCAATACGACTCACTATAAGTAGAAACAAGG ... The HA and NA sequences showed that A/ Oklahoma /323/ 03 is similar to the A/ Fujian/411/02 vaccine strain [8] while A/ Oklahoma/1992/05, A/ Oklahoma/309/06 and A/ Oklahoma/483/08 are closely related ... Neu5Acα2–6Galβ1–4GlcNAc Neu5Acα2–6GalNAcβ1–4GlcNAc A/ OK/ 309/06 (Wisconsin-like) Neu5Acα2–6Galβ1–4GlcNAc Neu5Acα2–6GalNAcβ1–4GlcNAc 9OAcNeu5Acα2–6Galβ1–4GlcNAc Neu5Acα2–6GalNAc in any context A/ OK/ 483/08...

Ngày tải lên: 12/08/2014, 04:21

... four basic residues among five amino acids (aa) 262RRKAK To characterize whether this basic aa region may contributes to IN nuclear localization, we replaced an arginine and a lysine at positions ... and the luciferase activity was valued as relative luciferase units (RLU) Each sample was analyzed in duplicate and the average deviation was calculated Immunoprecipitation and Western blot analyses ... initiation codon (ATG) was placed prior to the first amino acid (aa) of IN The primers are 5'-IN-HindIII-ATG (5'-GCGCAAGCTTGGATAGATGTTTTTAGATGGAA-3') and 3'-IN-Asp718 (5'-CCATGTGTGGTACCTCATCCTGCT-3')...

Ngày tải lên: 13/08/2014, 09:21

... observed while maximizing the ability to degrade carry-over amplicon DNA contamination in a sample Results Effect of UNG concentration on DNA degradation and RTPCR amplification of RNA To assess the ... amplification of target RNA in samples with very low concentrations Conclusion Quantitative assessment of the effect of UNG on DNA degradation and RNA amplification over a range of enzyme concentrations, ... DNA could be degraded at the same time that RNA was amplified and quantified by real-time RT-PCR, viral RNA was contaminated with amplicon DNA prior to UNG incubation and RT-PCR amplification...

Ngày tải lên: 19/06/2014, 08:20

... observed while maximizing the ability to degrade carry-over amplicon DNA contamination in a sample Results Effect of UNG concentration on DNA degradation and RTPCR amplification of RNA To assess the ... amplification of target RNA in samples with very low concentrations Conclusion Quantitative assessment of the effect of UNG on DNA degradation and RNA amplification over a range of enzyme concentrations, ... DNA could be degraded at the same time that RNA was amplified and quantified by real-time RT-PCR, viral RNA was contaminated with amplicon DNA prior to UNG incubation and RT-PCR amplification...

Ngày tải lên: 20/06/2014, 04:20

... 5'-GTA AAA CGA CGG CCA GT GRA CHC ARG ART CIK MRTG-3'- and NA10R-M13 5'-CAG GAA ACA GCT ATG AC CCI IKC CAR TTR TCY CTR CA-3' or NA8F 5'-GRA CHC ARG ART CIK MRTG-3' and NA10R 5'-CCI IKC CAR TTR ... RT-PCR Amplicons (10 μL/sample) were visualized by gel electrophoresis on 1.5% agarose containing ethidium bromide Abbreviations AAHL: Australian animal health laboratory; AGRF: Australian genome ... 6) A/ Shearwater/Aust/75 7) A/ Grey teal/WA/1762/79 8) A/ Emu/NSW/97 9) A/ Turkey/Ontario/6118/67 10) A/ Shearwater/Aust/72 11) A/ Mallard/Gurjev/263/82 12) A/ Mallard/Gurjev/244/82 13) A/ Gull/Maryland/704/77...

Ngày tải lên: 20/06/2014, 01:20

... TTGCCCAGTCAGGACCAAAT 62/1.90 CAACATCCTTTACCCATTGACAGA/ GCATTTGATCCACTTGCAGATAAG GGATAACTTCCCTGCCTCAATGA/ TTCTTGTAGCAGCTGAGAGGATCA CATGCGAGTGTCCCTCAATCT/ TCTCTTGCGTTTCTGGCTTAGA CAGCCAGATCTTCACGAGCTT/ ... GTTCTCGCGCATTGACCATA TGAACCACTTGATCTCTGCGACTA/ CAGCTTGCGGAGGTCTGAGT GAGGGTCGTCAGGATTTGGA/ GCCCTGCACTTACCATCTTTAAG CATAACATTTGCGGCAGATCA/ TGGTGGTATTATTGAGCCATCCTT CGCCTGTCAATCTTGGTCAGTAT/ AATGGCTATGCCCCTGTTCTG ... CTTGCATCCCTCAGCACCTT/ TCCTGTGGACAATGGATGGA 82/2.00 GGTTCCCATGTTTACAGCATCTG/ GCACCCACTCAACGGTATTGTAC TCCGCCAAGGACTATCATGAC/ CGCAATCAGAGCCCTGTAGAA GGAGCCTGAGCCTACCTTCTC/ GTGTTCGGCCAGGTGGTAGA GAACTGGGTGCTTGATAGGC/...

Ngày tải lên: 12/08/2014, 05:20

... NA7R ORF7-F ORF7-R PCV2 -A2 PCV2 -A3 CSFV-F CSFV-R Trình tự mồi [5’ – 3’] CAG CCA GTC AAT CAG CTG TG GAA CGT TCG GTC TGG GTG AG ATC CTC CCT GAA TCT GAC AGG TGG GTG GCA GAA AAG CTG TT GTG TCA ATC ... Cộng aa Amino acid Axit amin nt Nucleotide Nucleotit Deoxyribonucleic acid triphosphate Deoxynucleosit triphotphat Loading buffer Đệm tra mẫu Number Số lƣợng mẫu Polymerase Chain Reaction Phản ... Deoxyribonucleic acid Số h a Trung tâm Học liệu Tên tiếng Việt http://www.lrc-tnu.edu.vn/ DNA Deoxyribonucleic acid Axit Deoxyribonucleic RNA Ribonucleic acid Axit Ribonucleic Base paire Cặp bazơ...

Ngày tải lên: 30/11/2015, 20:08

... CAGGTCCAGTTTTTTTTTTTTTTTAACTATGCAACCTACTACCTCT miR-2 0a miR-21 UAAAGUGCUUAUAGUGCAGGUAG UAGCUUAUCAGACUGAUGUUGA ACAGTAAAGTGCTTATAGTGCA TCAGTAGCTTATCAGACTGATG GTCCAGTTTTTTTTTTTTTTTCTACCT CGTCCAGTTTTTTTTTTTTTTTCAAC CAGGTCCAGTTTTTTTTTTTTTTTCTACCTGCACTATAAGCACTTTA ... CAGGTCCAGTTTTTTTTTTTTTTTAACTATACAACCTACTACCTCA let- 7a UGAGGUAGUAGGUUGUAUAGUU GCAGTGAGGTAGTAGGTTGT GGTCCAGTTTTTTTTTTTTTTTAACTATAC let-7d AGAGGUAGUAGGUUGCAUAGUU AGAGAGGTAGTAGGTTGCAT AGGTCCAGTTTTTTTTTTTTTTTAACT CAGGTCCAGTTTTTTTTTTTTTTTAACTATGCAACCTACTACCTCT ... UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGAUUGUAUAGUU AUCACAUUGCCAGGGAUUUCCA AUCACAUUGCCAGGGAUUACCA UCCCUGAGACCCUAACUUGUGA UCCCUGAGACCCUAACUCGUGA UCUCCCAACCCUUGUACCAGUG UCUCCCAAUCCUUGUACCAGUG Cq % of specific signal...

Ngày tải lên: 23/03/2014, 22:20

... CGCACGGGTGAGTAAGGTA GCTTAACACAAGTTGACTAG Campylobacter jejuni 63°C/30 secs 2.5 70 CGCACGGGTGAGTAAGGTA GTCTTACATAAGTTAGATA Campylobacter concisus 55°C/30 secs 2.0 70 CGCACGGGTGAGTAAGGTA ATACCTCATACTCCTATTTAAC ... for AGTAGTTTACTACTTTGCCG ACTGCTGCCTCCCGTAGGAG Universal (R1 and R2) 58°C/60 secs 1.5 350 CATAACGTCGCAAGACCAAA GTGCAATATTCCCCACTGCT E coli 58°C/45 secs 1.5 187 TTGGGAATAACGGTTGGAAA TGTCTCAGTCCCAGTGTTGG ... Campylobacter-associated ReA, one Chlamydia-associated ReA, one RA sample and one undifferentiated arthritis sample) In contrast, Chlamydia tracho- matis sequences were only ever detected in samples taken from patients...

Ngày tải lên: 09/08/2014, 01:21

... detection and cellular localisation of transcriptional expression The analysis of up to 70 sections in a single amplification experiment addresses the problem of experimental variability associated ... and amplification cycle were generated using the amplified PCR product as a template, and were used to calculate mRNA copy number in each sample Data were expressed as relative mRNA expression ... overview of methods, applications and limitations of a new molecular technique Virchows Arch B Cell Pathol Incl Mol Pathol 1993, 64:67-73 Osada T, Uehara H, Kim H and Ikai A mRNA analysis of single...

Ngày tải lên: 11/08/2014, 00:21

... glutathione S-transferase (GST) and NusA The GST-HuR fusion protein was unstable after purification and underwent substantial degradation at room temperature (Fig 2A) In contrast, the NusA-HuR ... (GE Healthcare, Piscataway, NJ) at pH 7.5 using a 0-1 M NaCl gradient NusA-RRM 1&2 was further purified on a Hi-Trap SP column (GE Healthcare, Piscataway, NJ) at pH 6.5 using a 0-1 M NaCl gradient ... Opaluch AM, Caldwell JS, Weitzman MD, Kuhen KL, Bandyopadhyay S, Ideker T, Orth AP, Miraglia LJ, Bushman FD, Young JA, Chanda SK: Global analysis of host-pathogen interactions that regulate early-stage...

Ngày tải lên: 12/08/2014, 23:23

... Rodríguez A, Ibañez P, Socias L, Cebrian J, Marques A, Guerrero J, Ruiz-Santana S, Marquez E, Del Nogal-Saez F, Alvarez-Lerma F, Martínez S, Ferrer M, Avellanas M, Granada R, Maraví-Poma E, Albert ... Critical Care Vol 13 No Gimeno and Navarro still suboptimal, is a reasonable alternative to nasopharyngeal swabs, provided that a specific laboratory protocol is followed Our findings alert us ... The ANZIC Influenza Investigators: Critical care services and 2009 H1N1 influenza in Australia and New Zealand N Engl J Med 2009, 361 [Epub ahead of print] Page of (page number not for citation...

Ngày tải lên: 13/08/2014, 19:20

... of DNA • restriction nucleases – proteins that cleave DNA at particular locations, enabling fragmentation into smaller parts in a predictable way • gel electrophoresis – separation of DNA fragments ... histone proteins • Spools organize into chromatin fibers that pack in regular ways, on different length scales Replication DNA replication is semi-conservative in a daughter strand one strand ... regions alternative splicing Translation Information transmission • bases in DNA/RNA to 20 amino acids in proteins • “translation” since the chemical language is different • How many nucleotides...

Ngày tải lên: 13/03/2014, 19:38

... Balakrishnan M, Palaniappan C, Fay PJ & Bambara RA (2000) Unique progressive cleavage mechanism of HIV reverse transcriptase RNase H Proc Natl Acad Sci USA 97, 11978–11983 Wisniewski M, Balakrishnan ... reverse transcriptase: mutational analysis and separate expression of the DNA polymerase and RNase H activities Proc Natl Acad Sci USA 85, 1777–1781 10 Schultz SJ & Champoux JJ (1996) RNase H domain ... Enzyme activity and catalysis Retroviral RNases H are partially processive endonucleases that cleave the RNA strand of a DNA ⁄ RNA hybrid in a Mg2+-dependent reaction to produce 5¢ phosphate and...

Ngày tải lên: 30/03/2014, 02:20

... -3′) AAGGAACTATAGTATGGCGAA CTGTTGCTGGTCTCTTGT TGGACCTACAAATTGCACCAATATAACCTCTTACAGTTGCAAAGTG AAGGACCCAGAGTGATGAGGTATGTATTTTCTTCCTTGGAACTT CTCTTAGCTGCTAGTTCTGAAGC CCCTCGAAAGAATCTATTCAGGG The RT-LAMP ... Findings A one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the rapid identification of SBV The data demonstrated that, in a simple water bath, ... Corresponding Affiliation: Aff1 Phone: +86-23-46792362 Fax: +86-23-46792362 Email: a5 12156093@qq.com Aff1 Chongqing Academy of Animal Science, Chongqing 402460, China Aff2 Rongchang Bureau of Animal...

Ngày tải lên: 21/06/2014, 19:20

... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/42A...

Ngày tải lên: 07/08/2014, 18:21

... cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed by restriction endonuclease digestion and religation The deletional mutants were ... quantification of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according to the amount of GAPDH mRNA in the sample Authors' contributions Heather Jaspan ... different reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across at least three reactions in which approximately equal amounts...

Ngày tải lên: 11/08/2014, 08:20

... 11(7):646-53 Mehrotra R, Pandya S, Chaudhary AK, Kumar M, Singh M: Prevalence of oral pre-malignant and malignant lesions at a tertiary level hospital in Allahabad, India Asian Pac J Cancer Prev 2008, ... a potentially malignant oral lesionsa Table Concordance of results of HC-II assay and PCR test for detection of HPV infection in oral squamous cell carcinoma (OSCC): a malignant oral lesionsa ... quid are rampant in this area Besides the main risk factors of tobacco, smoking and alcohol, infection by human papillomavirus (HPV) and genetic alterations are likely to play an important role...

Ngày tải lên: 12/08/2014, 01:22

... staging, and fusion assay TC participated in staging and fusion assay AH participated in in vivo correlation studies All authors have read and approved the manuscript Acknowledgements The authors thank ... forward, 5'-AAGCAAGTGTGTGTTCCCATCT-3'; late RT reverse, 5'-CACTTACCTGCAACCGGAGG-3'; integrated forward, 5'-GCTGCCGATTGGGATTTACAAC3'; integrated reverse, 5'-AATGTCTGATCCTCTTGGCTCTC-3' Quantification ... infection for quantitation of early reverse transcription (early RT), late reverse transcription (late RT), and integrated viral DNA copy number using quantitative real time PCR Spearman correlations...

Ngày tải lên: 12/08/2014, 04:20

... 32 raccoon F vacc C V+/W+ 33 raccoon F vacc C V-/W- 34 raccoon F vacc C V-/W+ 35 raccoon F vacc C V-/W+ 36 raccoon M vacc S V-/W- 37 raccoon M vacc S V-/W+ 38 raccoon M vacc C V-/W- 39 raccoon ... (5'-ACGTCCTGGACCCTAAGTTTTG-3') was used as a shared reverse primer P5(5'-GGTTTTATAAAAGATT), p6(5'-ATCTAGAGGTAA-3') were used as the primer specific for different CDV vaccine strains Primer pairs ... (5'-AAATCCTGTGTTACCCGCTC-3'), P2 (5'-TGGTGGCTCTGCAATATGAA3'), and P3 (5'-AATGAATGGATGCCTGGGGTTT-3') were used as the primer specific for CDV species, wildtype strains, and vaccine strain Onderstepoort,...

Ngày tải lên: 12/08/2014, 04:20