a novel treatment for breast cancer
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro ... by a G1 DNA content of 40.8% 980 PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER Figure FISH preparations of interphase cells from a human B-lymphoid cell line and MGR1 brain cancer...
- 8
- 670
- 0
báo cáo khoa học: " Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy" ppsx
... NFκB κ MIAPaCa Figure 11 Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell lines Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell ... 2):S276-280 Aggarwal BB, Shishodia S, Takada Y, Banerjee S, Newman RA, BuesoRamos CE, Price JE: Curcumin suppresses the paclitaxelinduced nuclear factor-kappaB pathway in breast cancer cells and inhibits ... proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation Mol Pharmacol 2006, 69:195-206 Hidaka H, Ishiko T, Furuhashi T, Kamohara H,...
- 18
- 312
- 0
Báo cáo hóa học: " A Novel Docetaxel-Loaded Poly (e-Caprolactone)/Pluronic F68 Nanoparticle Overcoming Multidrug Resistance for Breast Cancer Treatment" pot
... in human breast cancer cells and therefore have considerable potential for treatment of breast cancer Acknowledgments The authors are grateful for financial support from the National Natural Science ... used in the treatment of breast cancer, oval cancer, small and nonsmall cell lung cancer, prostate cancer, etc Its commercial formulation TaxotereÒ is formulated in high concentration of Tween ... internalize through a macropinocytosis-dependent pathway A significant amount of nanoparticles transcytose accumulate at the basolateral membrane Some anionic but not cationic nanoparticles transited...
- 10
- 363
- 0
báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps
... Conclusions Early stage breast cancer can be treated with breast conserving therapy and accelerated partial breast irradiation using electronic brachytherapy Treatment was well tolerated, and these early ... criteria were based on the Page of 10 American Society of Breast Surgeons Consensus Statement for Accelerated Partial Breast Irradiation and the American Brachytherapy Society Breast Brachytherapy ... Potential applicability of balloon catheter-based accelerated partial breast irradiation after conservative surgery for breast carcinoma Cancer 2004, 100:490-498 23 Arthur DW, Vicini FA, Kuske...
- 10
- 389
- 0
báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc
... 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as a form of hormonal manipulation for breast cancer World Journal of ... treatment in advanced breast cancer Lancet 1974, 2:38-39 Hayward JL, Carbone PP, Heuson JC, Kumaoka S, Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project ... on treatment Results Seventeen patients with either locally advanced primary (n = 3) or metastatic (n = 14) breast cancer had “withdrawal” treatment as 2nd to 10th line of treatment Patient and...
- 4
- 253
- 0
báo cáo khoa học: "Detection of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening" doc
... Santa Cruz, Santa Cruz, CA Santa Cruz, Santa Cruz, CA Polyclonal Antibodies Anti-MSH2 (Ab-3) Pc57 Calbiochem, San Diego, CA Anti-MLH1 (Ab-2) Pc56 Calbiochem, San Diego, CA Rabbit anti-MSH2 A3 00-02 0A ... sequencing and microsatellite analysis are accurate, but are more expensive, take longer to do, and are mainly available at commercial laboratories Also, DNA sequencing and microsatellite analysis is often ... interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair Nucleic Acids Research 1998, 26:1173-1178 Yamasaki Y, Matsushima M, Tanaka H, Tajiri S, Fukuda R, Ozawa H, Takagi...
- 7
- 334
- 0
Liposomal co encapsulation of quercetin with synergistic chemotherapeutic drugs for breast cancer treatment
... cancer 1.3 Treatment regimens against breast cancer Surgery and radiation are often used to treat early stage localized breast cancer Besides surgery and radiation, additional treatment modalities ... clinical trials and approval, with four products available on the market for cancer treatment (Table 3) and many liposomal formulations are currently undergoing clinical trials (Table 4) Table Marketed ... Liposomal irinotecan Advanced solid tumor Phase I Liposomal irinotecan: floxuridine Advanced colorectal cancer Phase II Liposomal mitoxantrone Advanced cancer Phase I Liposomal pacilitaxel Advanced...
- 208
- 483
- 0
A novel algorithm for the reconstruction of an entrance beam fluence from treatment exit patient portal dosimetry images
... an array of ion chambers located upstream of the patient This requires a special iii hardware device and places an additional attenuator in the beam path, which may not be desirable A final approach ... backplane, on it a 147 GB drive Additional storage was added for storing historical calculations, a 400 GB ATA drive This master was configured to also act as a node for calculations, with all ... crossing, and for electron stepping Additional parameters are available for the selection among various cross section databases for bremsstrahlung interactions, Compton scattering, pair production, and...
- 245
- 577
- 0
Tài liệu Screening for Breast Cancer: Systematic Evidence Review Update for the U. S. Preventive Services Task Force doc
... Consortium Available at: http://breastscreening .cancer. gov/ Ballard-Barbash R, Taplin SH, Yankaskas BC, et al Breast Cancer Surveillance Consortium: a national mammography screening and outcomes database ... Screening a Mammography (film and digital) or MRI for age 40-49 years and ≥70 years b Clinical breast examination alone and with mammography (all ages) c Breast self examination (all ages) Average-risk ... Health Organization (WHO) Screening for breast cancer Available at: http://www.who.int /cancer/ detection/breastcancer/en/index.html Canadian Task Force on Preventive Health Care Breast self-examination...
- 95
- 1,014
- 0
Tài liệu SCREENING FOR BREAST CANCER WITH MAMMOGRAPHY ppt
... on surgical treatment for breast cancer in Norway: comparative analysis of cancer registry data BMJ 2011;343:d4692 20 NHS cancer screening programmes BASO Breast Audit 1999/2000 www.cancerscreening.nhs.uk/breastscreen/publications.html ... Screening for breast cancer with mammography Cochrane Database Syst Rev 2009;4:CD001877 (available at www.cochrane.dk) Nyström L, Rutqvist LE, Wall S, et al Breast cancer screening with mammography: ... something that might be cancer, the woman is recalled for additional investigations In some cases it turns out that what was seen on the X-ray was benign, and that it was therefore a false alarm If...
- 15
- 528
- 3
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... medium for 30 For HPLC analyses, cells were harvested after h, and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a...
- 12
- 497
- 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c ... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs...
- 8
- 401
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
- 11
- 475
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... scDNA (B) Ethidium stained agarose gel: lane 1, scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and ... supernatants or ascites by means of affinity chromatography using either protein G-Sepharose (Pharmacia) or protein L-Sepharose (Pierce) horseradish peroxidase conjugated anti-rabbit IgG (Sigma) ... lanes and 7, no mAb; lanes and 8, DO-1; lanes and 9, ICA-9; lanes and 10, Bp53-6.1; lanes and 11, Bp53-10.1 Bands denoted as ÔscÕ and ÔocÕ correspond to free monomeric scDNA and open circular...
- 12
- 265
- 0
a novel method for the synthesis of titania nanotubes using
... crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method and annealed ... Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 363 466 0A) After an initial increase-decrease transient, the current reached a steady-state value The anodized samples were properly washed ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent ... the final temperature (for min); the temperature 2-CEPS was increased at rate of 20 oC/ for 13 Also, detector temperature was 230 oC Experimental Materials Synthesis of CaO nanoparticles catalyst...
- 12
- 705
- 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with ... The Average CV (CV computed for each patient, then all patients averaged) is shown for each phenotype All Average CV values are less than 16%, suggesting stable expression over time for each...
- 15
- 476
- 0
Báo cáo sinh học: " Body fluid derived exosomes as a novel template for clinical diagnostics" pptx
... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...
- 9
- 368
- 0
Báo cáo sinh học: " Encapsulation of docetaxel in oily core polyester nanocapsule intended for breast cancer therapy" pptx
... Japan) and photographed digitally on a Gatan axismount 2k × 2k digital camera (Gatan, Inc., Pleasanton, CA, USA) The freeze-dried samples were put into a small mold, referred to as a BEEM capsule, ... TEM for imaging on a Gatan digital camera Powder X-ray diffraction pattern analysis Powder X-ray diffraction [PXRD] analysis of the freeze-dried NCs was performed using a MiniFlex automated X-ray ... 10 kDa and 30 to 70 kDa) and ethyl acetate were obtained from Sigma-Aldrich (St Louis, MO, USA) Docetaxel or Doc was purchased from LC Laboratories (Woburn, MA, USA) Labrafac CC (caprylic/capric...
- 24
- 474
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
... Pain and self-reported characteristics Self-rated pain was assessed as pain at the moment and measured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on ... engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work References Competing interests The study was supported by funding from Alfta ... the data acquisition, and the statistical analyses and drafted the manuscript MBJ participated in the design and coordination of the study, the statistical analyses and helped to draft the manuscript...
- 10
- 712
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25