a novel therapeutic target in human atherosclerosis

... transformation carcinoma, lung adenocarcinoma, in vitro and tumor ovarian cystadenocarcinoma, formation in mice colorectal carcinoma, renal cell (J.K Cheong et al, carcinoma, osteosarcoma and ... to include cutaneous and intracavitary superficial mucosal lesions such as vulvar intraepithelial neoplasia, cervical dysplasia or carcinoma in situ, oral cancer and nasopharyngeal bladder cavity ... include an N-terminal basic cyclin A- binding motif (containing a putative nuclear localization signal), a novel uncharacterized motif termed SERTA (SEI-1, RBT1 and TARA), a PHD zinc finger- and/or...

Ngày tải lên: 12/09/2015, 08:19

... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm ... fifth cause of death among all cancers The annual incidence is increasing at a rate of 0.5% globally, and at 4% in Asia, making the estimated new cases at 1.5 million in year 2010 (1) At present, ... 2000;165(2):1153-9 52 Ohminami H, Yasukawa M, Kaneko S, Yakushijin Y, Abe Y, Kasahara Y, et al Fas-independent and nonapoptotic cytotoxicity mediated by a human CD4(+) Tcell clone directed against an acute myelogenous...

Ngày tải lên: 12/09/2015, 09:59

... (Grand Island, NY) The synthetic arginine-glycine-aspartic acid (RGD) containing peptide was purchased from American Peptide Company (Sunnyvale, CA) Primary antibodies against HSP20, cofilin, ... diluted appropriately in serum-free media on the day of use Statement on animal welfare Fischer 344 rat strains (male, 7-9 wk-old) were purchased from Harlan Sprague-Dawley, Inc (Indianapolis, IN) and ... concentration-dependent decreases in cell A B C D Pa Figure Spatiotemporal changes in cell traction forces Phase contrast (A) and traction field images (B, min; C, min; D, 10 min) of a single human ASM...

Ngày tải lên: 12/08/2014, 13:22

... the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct ... non-Hodgkin’s lymphoma as a single agent as well as in combination therapy, emphasizing its high B-cell-depleting potency [8] In patients with lymphoma, rituximab infusion is frequently associated ... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most...

Ngày tải lên: 09/08/2014, 01:21

... foregoing offer likely therapeutic advantage However, whether the IL-18R signalling pathway is sufficiently distinct from that of IL-1, which in turn has proven disappointing as a target in clinical ... Interleukin-18 (interferon-gamma-inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colonystimulating factor and not via interferon-gamma to inhibit osteoclast formation J ... that pathogenetically useful information at least is obtained Indeed one might usefully consider this as we progress with a range of novel therapeutic targets in RA Competing interests The author(s)...

Ngày tải lên: 09/08/2014, 06:22

... Taniguchi N, Kawahara K, Yone K, Hashiguchi T, Yamakuchi M, Goto M, Inoue K, Yamada S, Ijiri K, Matsunaga S, Nakajima T, Komiya S, Maruyama I: High mobility group box chromosomal protein plays ... improvement of disease after HMGB1 inhibition implicate HMGB1 as a key mediator and potential therapeutic target in RA HMGB1 as a novel therapeutic The recent article from Sundberg and colleagues [1] ... AR, GallowitschPuerta M, Patel NB, Huston BJ, Chavan S, Rosas-Ballina M, Gregersen PK, Czura CJ, Sloan RP, Sama AE, Tracey KJ: Cholinergic anti-inflammatory pathway activity and high mobility group...

Ngày tải lên: 09/08/2014, 10:23

... Chadi G: Glial bFGF and S100 immunoreactivities increase in ascending dopamine pathways following striatal 6-OHDA-induced partial lesion of the nigrostriatal system: a sterological analysis Int ... immunoreactivity mainly in astrocytes of rat facial nucleus The present findings are in line with our previous observations that adrenocortical steroid administration can increase FGF-2 mainly in ... Chadi G: Astroglial and microglial activation in the wistar rat ventral tegmental area after a single striatal injection of 6hydroxydopamine Int J Neurosci 2004, 114:197-216 25 Paxinos G, Watson...

Ngày tải lên: 10/08/2014, 10:20

... little data on haematological cancers Notable findings include that of single-agent activity for RHSP4 in a metastatic melanoma model, as well as in a melanoma line resistant to the platinum drug ... telomestatin, induce rapid replicative senescence in cancer cells and activate the same DNA damage response that follows DNA double-strand breaks This involves in particular ATM, p16INK 4a kinase and ... available data Studies in combination with established anticancer drugs G4 ligand Xenograft model BRACO-19 AS1410 RHPS4 A4 31 epidermal carcinoma A5 49 lung carcinoma UXF1138L human uterine carcinoma HCT116,...

Ngày tải lên: 06/03/2014, 09:22

... inactivation of c-aminobutyric acid transaminase by gabaculine and more recently by others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and ... bioA gene, the primers were the following: 5ÂCGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3Â containing an EcoRI restriction site, a ribosome-binding site and a His6 tag coding ... recombinant gene: 5Â-CGCGCGAATTCAG GAGGAATTTAAAATGGCTGCGGCGACTGGCGGG-3Â containing an EcoRI restriction site and a ribosome-binding Expression and purication of wild-type and His6-tagged recombinant...

Ngày tải lên: 07/03/2014, 11:20

... Methylation analysis was performed as described previously [16] The relative proportions of the various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses ... adds Neu5Ac in an a- 2,3linkage to lactose in other H in uenzae strains, is present in strain 981 (data not shown) Sialyllactose is known to contribute to the resistance of H in uenzae strains to ... A (62 mg) was separated by centrifugation and the water-soluble part was repeatedly chromatographed on a P-4 column, giving a major (OS-1, 8.5 mg) and a minor (OS-2, 3.7 mg) OS-containing fraction...

Ngày tải lên: 08/03/2014, 02:21

... and bacterial, protease contamination Protein concentration was determined with a Bio-Rad protein assay kit using BSA as a standard according to the manufacturer’s protocol Any bacterial and protease ... staining as described in Materials and methods Marker proteins and their corresponding molecular masss are indicated in lane Lane 2, material from the acid extracts of granules; lane 3, material ... database and search engine Mass determination of proteins was done with the same instrument operated in linear mode and externally calibrated with a mixture of proteins Protein determination and...

Ngày tải lên: 16/03/2014, 04:20

... As shown in Fig 1B, three commercially available polyclonal antibodies (anti-PKAacat, antiPKAbcat and anti-PKAccat) and one monoclonal A T-cell Jurkat NT2 antibody (anti-Cmono) were immunoreactive ... RIa and RIIa to form PKAI and PKAII in T cells (A) Confocal laser immunofluorescence of human T cells using anti-Cb2(SNO103) in combination with anti-RIa and anti-RIIa Human T cells were incubated ... specificity (anti-PKAacat, anti-PKAbcat and anti-PKAccat; catalogue numbers sc903, sc904, sc905; Santa Cruz Biotechnology, Santa Cruz, CA, USA); a monoclonal anti-C antibody (anti-Cmono; catalogue...

Ngày tải lên: 16/03/2014, 18:20

... Contents Part Chapter Part Blood-Brain Barrier in Glioma Therapy 109 Blood-Brain Barrier and Effectiveness of Therapy Against Brain Tumors 111 Yadollah Omidi and Jaleh Barar Gene Therapy of Glioma 141 ... Gabellini Antioxidant Adaptive Response in Glioma 245 Antioxidant Adaptive Response of Malignant Glioma Related to Resistance to Antitumor Treatment Tomohiro Sawa and Takaaki Akaike 247 TRP Channels ... three imaginary intersecting spatial planes based on a Cartesian coordinate system Any point within the brain can be specified by measuring its distance along these three planes This provides a precise...

Ngày tải lên: 23/03/2014, 15:20

... The C-terminal amino acid was amidated in all three chrysophsins, similarly to those in marine animals, such as solitary ascidians (styelin D) [31] and hybrid striped bass (Morone saxatilis x ... equal against B subtilis and E coli (Table 2), bactericidal activity against fish and crustacean pathogens was investigated with the synthetic chrysophsins (Table 3) All three were active against ... KCl, and 43–48 0.4–1 M KCl CA, USA) by analyzing the data calibrated with 10 pmol phenylthiohydantoin amino-acid standards Tricine/SDS/PAGE The molecular mass of the sample was estimated by Tricine/...

Ngày tải lên: 23/03/2014, 20:22

... protein isolation as described previously [48] Cell culture and shRNA knockdown The HepG2 human liver carcinoma cell line, MIA PaCa-2 human pancreatic carcinoma cell line and the human adenocarcinoma ... PCR amplification with Chip1up primer (5¢-aagctccagagggtctgcac-3¢) and Chip1dw primer (5¢-gaaaggcatcccgaacgcat-3¢); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3¢) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3¢); ... Tata-box binding protein (TBP) reference gene (C) Total RNA was isolated from stable Caco-2 ⁄ 15 cell populations that contained an integrated shRNA against the CUX1 mRNA or a mutated shRNA as a control...

Ngày tải lên: 29/03/2014, 21:20

... nippona The same amount of sample was applied to each lane Lane M, molecular mass standards; lane A, CBB staining; lane B, Stains-all staining; lane C, negative staining; lane D, Methyl green staining ... buffer containing 2-mercaptoethanol after boiling, and subsequent staining procedures with negative staining, Stains-all and Methyl green visualized an exclusive band of approximately 52 kDa, which ... preferably over Glu, and a single Cys residue was located at its center A search of the nonredundant GenBank CDS database using blast (protein–protein blast and Search for short, nearly exact matches)...

Ngày tải lên: 30/03/2014, 04:20

... this article as: Rahma et al.: A pilot clinical trial testing mutant von Hippel-Lindau peptide as a novel immune therapy in metastatic Renal Cell Carcinoma Journal of Translational Medicine 2010 ... by helping in the manuscript drafting Drs Samara and Abdalla are postdoctoral fellows at the National Cancer Institute Author details Vaccine Branch, NCI, NIH, Bethesda, MD, USA 2Medical Oncology ... RRIHSYRGDLWLFRDA MEAGRPRPCCAR RLALQRCRDTRWA Rahma et al Journal of Translational Medicine 2010, 8:8 http://www.translational-medicine.com/content/8/1/8 Page of Table VHL mutations and HLA types in vaccinated...

Ngày tải lên: 18/06/2014, 16:20

... (5'TG AAAACTGAACAAAAGAC3') together with one of the reverse primers S1OLIGO3' (CTAAACTAACATAAGGG C3') or degenerate3'-2 (5'CCATAAGTAACATAAGGG CAA3') [14,16] The RT reaction for synthesis of cDNA ... (Promega, USA) and transformed into JM 109 competent cells (Promega, USA) The cells carrying recombinant plasmids were selected on Luria-Bertani agar plates containing ampicillin, X-gal and IPTG, and ... - Arkansas KM91‡ KM91 KM91 KM91 KM91 Variant KM91 Variant Variant Variant Variant GenBank accession numbers AY790368 AY790359 AY790360 AY790358 AY790362 AY790361 AY790366 AY790365 AY790363 AY790364...

Ngày tải lên: 07/08/2014, 20:23

... perinuclear localisation of the channel leading to activation of Mitogen activated protein kinase (MARP) pathway resulting in increased cell proliferation The Eag channels also act through the Ca calmodulin ... independent of K+ influx through the channel Eag channels also act as a scaffold for and activate Calcium -Calmodulin activated kinase II (CaMKII), forming a complex which remains active even in the presence ... Warmke JW, Ganetzky B: A family of potassium channel genes related to eag in Drosophila and mammals Proc Natl Acad Sci USA 1994, 91(8):3438-42 16 Harmar AJ, et al: IUPHAR-DB: the IUPHAR database...

Ngày tải lên: 09/08/2014, 03:24