a novel encounter with big data
báo cáo hóa học:" The net cost of incorporating resistance testing into HIV/AIDS treatment in South Africa: a Markov model with primary data" pot
... the National Health Laboratory Service (authors’ data) All costs are shown in US dollars after applying the 2008 average exchange rate of 8.28 South African rands to one US dollar [5] An annual ... Discount rate applied 3.0% to future costs (annual) Exchange rate (Rand/$) 8.28‡ *Long et al, 2010 [5] † Authors’ data from National Health Laboratory Service, South Africa ‡ Exchange rate taken from ... second-line antiretroviral therapy for HIV/AIDS in South Africa AIDS 2010, 24:915-919 Fox MP, Brennan A, Maskew M, MacPhail P, Sanne I: Using vital registration data to update mortality among patients...
- 6
- 386
- 0
A Horn Fragment with PTime Data Complexity of Regular Description Logic with Inverse
... of KB validates ϕ If KB |= C (a) then we say that a is an instance of C w.r.t KB 2.2 Automaton-Modal Operators Given an interpretation I and a finite automaton A over alphabet R, define AI = { x, ... following: A = R, QA , qA , A , FA If q is a state of a finite automaton A then by Aq we denote the finite automaton obtained from A by replacing the initial state by q Lemma Let I be a model of a regular ... R is a regular RBox with the following RIA-automatonspecification: Note that Ar = (Ar )0 and Ar = (Ar )0 Consider the Horn-RegI knowledge base KB = R, T , A with A = {A( a), B (a) , A( b), r (a, b)}...
- 15
- 257
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported financially by a grant from ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
- 7
- 612
- 1
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...
- 8
- 499
- 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
... plants Microalgae cultivation and reclamation Wastewater Artificial wetland Disinfection Primary settled sludge Microalgal cells Organics in high concentration Oil extraction Environmental and ... centrifugation, and filtration, could be applied By separating microalgal cells from the wastewater, clean water with low content of organics and inorganic nutrients could be obtained, and also the ... very important in the microalgal cultivation unit of the novel process Harvest of microalgal biomass The microalgal biomass needs to be separated and harvested from the microalgal cultivation unit...
- 9
- 762
- 0
Tài liệu Create a New Table with Data from Existing Tables doc
... build the data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch ... odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End Sub ... DataSource property is set to the data table that was filled Listing 6.17 frmHowTo6_7.vb: Loading the Form Private Sub btnExecute_Click(ByVal sender As System.Object, ByVal e As System.EventArgs)...
- 4
- 376
- 0
Tài liệu Getting Started with Oracle Data Integrator 11g: A Hands-On Tutorial pptx
... analysis, data architecture, data modeling, data migration and integration, ETL, data quality, data cleansing, business intelligence, database administration, data mining, and enterprise data warehousing ... 10 years He began his career as a Database Application Programmer and quickly developed a passion for the SQL language, data processing, and analysis He entered the realm of BI and data warehousing ... data Job roles that are a likely match include ETL developers, Data Warehouse Specialists, Business Intelligence Analysts, Database Administrators, Database Programmers, Enterprise, or Data Architect,...
- 384
- 4,335
- 2
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT ... DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢) without...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt
... mitochondria was analyzed by thiobarbituric acid assay [34] In this assay, thiobarbituric acid reacts with malonaldehyde and or other carbonyl by-products of free-radicalmediated lipid peroxidation ... thiobarbituric acid reactive substances (TBARS) as a marker for lipid peroxidation, and 6-CySeCD, 6-SeCD and Ebselen as antioxidants in ferrous sulfate ascorbate-induced mitochondrial damage ... EDTA, 0.25 mm NAPDH, unit GSH reductase and lm 6-CySeCD Background absorption of the noncatalytic reaction was run without mimic and was subtracted Kinetic data were analyzed by double-reciprocal...
- 9
- 491
- 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... for caspases and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, and Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC ... caspase 1, WEHD-AMC; caspase 2, VDVADAMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; caspase 8, IETD-AMC; caspase 9, LEHD-AMC; caspase ... DVPD-AMC are increased when apoptosis is induced In contrast, cleavage of the p27KIP1 DPSD-AMC substrate remained constant under these assay conditions Thus it appears that KIPase maintains a basal...
- 8
- 442
- 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... cross-react with antibodies against plant helicases including PDH45 and PDH65 and also against human DNA helicases I, II, III and IV (data not shown) ssDNA-dependent ATPase activity was present at a ... 2A, lane 4) and ssDNA-dependent ATPase activity (data not shown) sedimented together between alcohol dehydrogenase and BSA (fraction 11) and gave a molecular mass of 120 kDa with a sedimentation ... substrates (Fig 5G and H) were prepared as described previously [11,15] 32 ATP-dependent DNA helicase and DNA-dependent ATPase assays The standard DNA helicase reaction was performed in a 10-lL reaction...
- 11
- 573
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... Escherichia coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid ... activity of peptides was assayed against several Gram-positive and Gram-negative bacteria using radial diffusion assay Petri dishes with Luria–Bertani agar were seeded with test bacteria The peptide...
- 10
- 505
- 0
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
... GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala Asn189 fi Ala Arg191 fi Ala Asp192 fi Ala Leu193 fi Ala Leu196 fi Ala The concentrations ... fi Ala Up: CAAGCGCGCTAGTGCTTCGGCAGGCG Down: CGCCTGCCGAAGCACTAGCGCGCTTG Up: CGCTAGTCCTGCGGCAGGCGCATTGG Down: CCAATGCGCCTGCCGCAGGACTAGCG Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG ... Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC...
- 11
- 440
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... stabilize ARE-containing mRNAs [68] and has been associated with the activation of c-Jun N-terminal kinase (JNK) [69] Similarly, activation of MAP kinase-activated protein kinase has been associated ... formaldehyde gel After transfer on a nylon membrane by capillary blot the RNA was hybridized with a 32P-radiolabelled MARCKS cDNA probe (p809.1) [22], washed and exposed to X-ray film (Kodak AR) with...
- 16
- 754
- 0
Getting Started with Oracle Data Integrator 11g: A Hands-On Tutorial ppt
... analysis, data architecture, data modeling, data migration and integration, ETL, data quality, data cleansing, business intelligence, database administration, data mining, and enterprise data warehousing ... 10 years He began his career as a Database Application Programmer and quickly developed a passion for the SQL language, data processing, and analysis He entered the realm of BI and data warehousing ... data Job roles that are a likely match include ETL developers, Data Warehouse Specialists, Business Intelligence Analysts, Database Administrators, Database Programmers, Enterprise, or Data Architect,...
- 384
- 7,639
- 5
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx
... has a point mutation at amino acid 408, was created by PCR-based site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA ... AAT TCA TGA CCC ATT GGT TTC ATA GGA ACC-3¢ and 5¢-GGG AAT TCT TAG GAG ATG TAG CAC CCA GTG TC-3¢ (nucleotides corresponding to a cDNA of the hypothetical protein C1orf58 are underlined), and an ... Peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgG were obtained from Wako (Osaka, Japan) Preparation of rabbit pAbs against Alix has been described previously [40] Cy3-labeled anti-mouse...
- 11
- 412
- 0
Báo cáo khoa học: "A Novel Word Segmentation Approach for Written Languages with Word Boundary Markers" pptx
... data Since the test data tend to have a similar error rate to the narrow standard deviation, we computed the overall performance over the average word spacing error rate, which is 9.1% The baseline ... test data and randomly insert spacing errors from 0% to 20% in the same way in which we made the development data We feel that this strategy can model both the intentional and un-intentional human ... using the relative frequency information of the training data, and a smoothing technique is applied to relieve the datasparseness problem which is the linear interpolation of n-grams that are used...
- 4
- 268
- 0
Spatial modelling of air pollution in urban areas with GIS: a case study on integrated database development doc
... relational database, so that the geospatial coordinate data of the GIS data layers are stored in the relational data tables Since the relational database supports relationships between its tables, ... spatial and temporal data, complex analyses, and visualization, (Matejicek, 2002) Due to the ability to manage a number of spatial and temporal data formats, data structures created in the framework ... values of variables are transferred and incorporated into the GIS database, which can be useful in managing data time series To accommodate large data sets and many variables such as air quality...
- 6
- 497
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
... Na+ channels available in databases were aligned with CLUSTAL X [45] The segments S5–S6 of domain I and S3–S4 of domain IV from selected sequences are shown (NaV1.1, 1.4 and 1.5 from rat; NaV1.7 ... Fig Final purification and amino-acid sequence determination of Cn12 (A) A sample of fraction II-4 from a CM-cellulose ionexchange column [33] containing mg protein was applied to an analytical C18 ... interferes with cellular communication at the level of the Na+ channels diagram of sequential and medium range data, the chemical shift index, and coupling constants used for the structure calculation...
- 13
- 434
- 0
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx
... cata ag ATGTCC AAGGAC gt aagt … ttaa ag GATTGC AGAAGA gt aagt … ttgc ag CAATTT ATGTTG gt aagt … tttt ag GGCATA ACTCAA gt aaga … tatc ag GATTTC AAGTAG gt aagt … attt ag CTTGCA CAAAAG gt aaga … ... ag ATGCCC AAGGAC gt aagt … ttca ag GATTGC AGAAGA gt aagt … ttgc ag CAATTT ATGTTG gt gagt … tttt ag GGCATA ACTCAA gt aagg … taat ag GATTTC ATGTAG gt aagt … atgc ag CTTGCA GCAAAG gt aaga … tcta ag ... ag ACGTAT TACTTG gt atgt … aatc ag GATATG ACAGAG gt aaaa … tctc ag AAAATT GCATTG gt aagg … attt ag GGCAGT CATTAT gt aagt … tttc ag GATATT TTGCAG gt ttgt … ttta ag GTTCAA ATGGAC gt atgt … cata...
- 9
- 470
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008