a novel approach towards gene targeting
Genomic organization and functional characterization of a novel cancer associated gene u0 44
... primers, TubF (50 -AACGTCAAGACGG CCGTGT30 ) and TubR (50 -GACAGAGGCAAACTGAGCAC-30 ), which amplify a 400 bp fragment of tubulin cDNA for normalization Cellular proliferation assays Preabsorption of ... -CACAATAATCTGGAGTTGTTTC-30 ) at the 30 end To generate the cDNA template for PCR cloning, total RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and mg of total RNA was ... HuUO-44 siRNAs U1, U2 and U 3a siRNA Sequence Target exon U1 U2 U3 50 -UGACUGUGCAGCUUGCAUUGCCUUC-30 50 -UAUCCAGGUAACCGCCACAGUUUGG-30 50 -AUAACUCUCAUCCUGUCAGAAGAGC-30 Exon Exon Exon Abbreviations:
Ngày tải lên: 14/09/2015, 21:59
Cloning and characterization of a novel kelch like gene in zebrafish
... R A S S V S S A P V S I 1981 TAAGCAGAGAGAGAGAGAGTGGTGGGTAAATGTATTTGAGTTGCTAAAGGTCAATTTATA * 2041 CTTCTGCGTCAAGTAGGTAGCACAGATCCGGCAAAGCTTCATCACACACTTTGGTCGTGC 2101 ACACTTCACCATACCAAATAAATGCAACTACATATTTCCGCGATGTGGAATGCAAGGTCT 2161 GTGATTGGTCAGATTTGGTAGAGATGACAAAATGTGGGCGGGGCCGACAGTTGTGAGAGA 2221 GAGGCAAGTGTTTAACAAGTGTCAAGTCCTATGGAGGAGCACTGTATGGATACGTTTGTT 2281 TTGTTTACTCTGTGATTAAAGTTATTAAACGTTAGAAAAAAAAAAA 56 Results context ... I 1981 TAAGCAGAGAGAGAGAGAGTGGTGGGTAAATGTATTTGAGTTGCTAAAGGTCAATTTATA * 2041 CTTCTGCGTCAAGTAGGTAGCACAGATCCGGCAAAGCTTCATCACACACTTTGGTCGTGC 2101 ACACTTCACCATACCAAATAAATGCAACTACATATTTCCGCGATGTGGAATGCAAGGTCT 2161 GTGATTGGTCAGATTTGGTAGAGATGACAAAATGTGGGCGGGGCCGACAGTTGTGAGAGA 2221 GAGGCAAGTGTTTAACAAGTGTCAAGTCCTATGGAGGAGCACTGTATGGATACGTTTGTT 2281 TTGTTTACTCTGTGATTAAAGTTATTAAACGTTAGAAAAAAAAAAA 56 Results context ... G 1381 436 1441 456 1681 536 1741 556 1801 576 GTGAGCACTGCAGGCGCTGCCACCTTGAATAACAAGATCTACCTCTTGGGCGGCTGGAAT V S T A G A A T L N N K I Y L L G G W N Kelch R6 GAGATTGAGAAGAAGTACAAGAAATGCATTCAGGTTTATAATCCTGATCTTAACGAATGG E I E K K
Ngày tải lên: 03/10/2015, 20:57
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications
... Staunen ist der Anfang der Erkenntnis Platon (ca 427 v.Chr - 347 v.Chr.) Summary Background and Aim: Ingestion of probiotics can modify gut microbiota and alter insulin resistance and diabetes development ... Lebensmittelwissenschaften (IEL) an der Landwirtschaftlichen Fakultät der Rheinischen Friedrich-Wilhelm-Universität Bonn Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors ... that daily intake of Lactobacillus (L.) reuteri increases insulin sensitivity by changing cytokine release and insulin secretion via modulation of glucagon-like peptide (GLP-1, GLP-2) release
Ngày tải lên: 19/11/2015, 16:47
TIẾP CẬN MỚI ĐIỀU TRỊ THA/ BỆNH NHÂN NHẬP VIỆN (A Novel Approach for the Management of Hypertension for Hospitalized Patients) BS NGUYỄN THANH HIỀN
... Black HR and Elliot WJ: Hypertension: A Comparison to Braunwald’s Heart Disease Sauders 2007; p: 327 – 339 Herzog E et al: A Novel Pathway for the Management of Hypertension for Hospitalized Patients ... al: A Novel Pathway for the Management of Hypertension for Hospitalized Patients Crit Pathways in Cardiol 2007; 6: 150 – 160 57 Braunwald’ Heart disease 2011: 947 THA thứ phát • Sử dụng dẫn ABCDE: ... Heart Disease Sauders 2007;; p: 340 – 350 54 Giles T D: Heart Failure as a Consequence of Hypertension IN Mann DL: Heart Failure A companion to Braunwald’s Heart Disease 2004; p: 405 – 414 THA,
Ngày tải lên: 05/12/2017, 00:59
The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life
... Chapter 21 The coach Chapter 22 ‘The Breakfast Club’ meets again Chapter 23 Twenty years later Author’s diagnosis About the author EULA Prologue All of our thoughts and actions towards money are ... seem, and Karen and Russ face challenges that are familiar to so many of us — juggling parenting, ageing parents, money pressures and work hassles Here are their vital stats: married for 17 years ... relax in a way she had not for a long time, as the steam dampened her hair and Brad’s arms encircled her She had enjoyed their nights together more than she cared to admit, and had fallen back
Ngày tải lên: 03/01/2020, 10:40
Rhizosphere management: A novel approach for improving the crop productivity
... fixation and VAM activity can be accelerated by the biochar (Guerena et al., 2015) Biochar can increase the pH of acidic soils, water holding capacity of soil and hasten the rate of organic matter ... Agriculture and Technology, Pantnagar, Udham Singh Nagar (UK) 263145, India *Corresponding author ABSTRACT Keywords Rhizosphere management, Plant management, Soil management, Soil health, Plant ... coexistence of near-isogenic salicylate-catabolizing and nonsalicylate-catabolizing Pseudomonas putida strains after exogenous salicylate application Appl Environ Microbiol 61:1073–1076 Zhang, H.M.,
Ngày tải lên: 09/01/2020, 20:09
A novel approach to monitoring the efficacy of anti-tumor treatments in animal models: Combining functional MRI and texture analysis
... data, and writing manuscript Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request Authors’ ... bevacizumab compared with that of paclitaxel To ensure the accuracy of our research, we adopted an alternative new technique, texture analysis, to analyze and verify the imaging results As a new ... multi-b-value DWI Pharmacokinetic parameters of CER (contrast enhancement ratio), Ktrans (transfer rate constant), Kep (reverse rate constant), Ve (extravascular extracellular volume fraction),
Ngày tải lên: 03/07/2020, 01:25
Synergisms of genome and metabolism stabilizing antitumor therapy (GMSAT) in human breast and colon cancer cell lines: A novel approach to screen for synergism
... of Health during his doctoral thesis Availability of data and materials All data generated or analysed during this study are included in this published article and its supplementary information ... combinatory approaches are needed An example for such a concept is CUSP9 where multiple drugs that are approved for non-cancer indications are combined as a treatment approach for recurrent glioblastoma ... Clairambault J Cell population heterogeneity and evolution towards drug resistance in cancer: biological and mathematical assessment, theoretical treatment optimisation Biochim Biophys Acta -
Ngày tải lên: 06/08/2020, 05:17
TRAIL-induced programmed necrosis as a novel approach to eliminate tumor cells
... (even a small) apoptotic caspase activation would ultimately translate into activation of caspase-3 and thus into an accumulation of cleavage fragments of PARP-1 and caspase-3 However, this was ... and DA designed research; SV, SP, PD and SWM performed research; SV, SP, SWM, CR, CA, AT, DK, SS, HK and DA analyzed data, SV and DA wrote the paper All authors read and approved the final manuscript ... Panc89, PancTu-I, A8 18-4, Pt45P1), colorectal adenocarcinoma (HT-29), gastric adenocarcinoma (MKN28), ovary adenocarcinoma (SK-OV-3), non-small cell lung carcinoma (KNS-62) and malignant melanoma (SK-Mel28))
Ngày tải lên: 05/11/2020, 01:07
Suppression subtractive hybridization identified differentially expressed genes in lung adenocarcinoma: ERGIC3 as a novel lung cancerrelated gene
... repeated three times Statistical analysis Measurement data (levels of mRNA and protein, the data of cellular migration and proliferation) and enumeration data (the data of immunohistochemical staining) ... adenocarcinoma: ERGIC3 as a novel lung cancerrelated gene Mingsong Wu1,2,3, Tao Tu1,4, Yunchao Huang5 and Yi Cao1* Abstract Background: To understand the carcinogenesis caused by accumulated genetic ... includes adenocarcinoma (AC), squamous cell carcinoma (SCC) and large-cell carcinoma The incidence of adenocarcinoma appears to be increasing globally Cancer is the result of the accumulation of genetic
Ngày tải lên: 05/11/2020, 07:04
A systems approach towards reliability centred maintenance (RCM) of wind turbines
... Database Manufacturing Database Maintenance & Repair Database (CMMS) Field Operations Database Repair Statistics Disassembly Data FMECA Data Test data Spare part information Machine & Tooling Material ... Technology, Atlanta, GA, March 19-22, 2013 A Systems Approach towards Reliability-Centred Maintenance (RCM) of Wind Turbines Joel Igbaa,b,*, Kazem Alemzadeha, Ike Anyanwu-Ebob, Paul Gibbonsa, John ... or making use of real field data for redesign Many Industries already have some form of database where field O&M and failure data are recorded A good example is the Offshore Reliability Data (OREDA)
Ngày tải lên: 04/12/2020, 17:01
A novel approach for travel time optimization in single track railway networks
... A Novel Approach for Travel Time Optimization in Single-Track Railway Networks Nguyen Quang Thuan1(B) and Nguyen Duc Anh2 Vietnam National University Hanoi-International School, Hanoi, Vietnam ... that divide railways into segments; Two trains or more are not allowed on any track segment; There are two tracks at sidings/stations and A Novel Approach for Train Scheduling Problems 29 each ... trains during rail operations Transp Res B 44(1), 175–192 (2010) 11 Corman, F., D’Ariano, A. , Hansen, I .A. , Pacciarelli, D.: Optimal multi-class rescheduling of railway traffic J Rail Transp Plan
Ngày tải lên: 17/03/2021, 17:28
A four-component modified Biginelli reaction: A novel approach for C-2 functionalized dihydropyrimidines
... novel approach for C-2 functionalized dihydropyrimidines Harsha NARKHEDE*, Avinash DHAKE, Vaidhyanathan BALASUBRAMANIYAN Department of Pharmaceutical Chemistry, S.M.B.T College of Pharmacy, Dist-Nashik, ... Balasubramaniyan V Department of Pharmaceutical chemistry, S.M.B.T College of Pharmacy, Dhamangaon, Nashik, M.S India422403 Prototype intermediate compounds and all final compounds are characterized ... such as, anticancer, calcium channel blocker, antiviral, antiinflammatory, antitubercular, antioxidant, and antibacterial activities [9,10,19–21] We also noticed that 5-acetyl DHPMs are conspicuously
Ngày tải lên: 13/01/2022, 00:32
A Novel Approach to the Part Orientation Problem for Robotic Asse
... The BarrettHand grasper programmably flexible part handling and assembly Industrial Robot: An International Journal, 27(3):181–188, 2000 [12] Jiansheng Dai and Zhang Qixian Metamorphic mechanisms ... of assembly robots These robots have four degrees of freedom (three rotational and one translational) Typically these robots are used for assembly tasks that take place along a vertical axis Many ... assembly tasks take place along a non-vertical axis To account for non-vertical axis assembly, parts must be fed in a proper orientation to allow for correct assembly Parts feeders and specialized
Ngày tải lên: 25/10/2022, 03:18
A combinatorial approach towards the design of nanofibrous scaffolds for chondrogenesis
... indicating an acceptable assay whereas a value between 0.5 to suggesting an excellent assay A negative value suggested an unacceptable assay The earliest time point with a Z-factor between and 0.5 was ... kept constant throughout the array negating any influence that variable fibre diameter may have had on biological performance A histogram of fibre diameters (Fig. 1A) displayed a normal distribution ... between material properties and biological performance Using this approach they demonstrated that substrates with high acrylate content and a moderate wettability are optimal for PSC colony formation
Ngày tải lên: 19/11/2022, 11:36
A novel approach combining self organizing map and parallel factor analysis for monitoring water quality of watersheds under non point source pollution
... to achieve its function in MATLAB The basic principle of PARAFAC analysis is an alternating least-squares algorithm which decomposes the data into a set of trilinear terms and a residual array, ... 27.8 D? ?a1 D? ?a4 A? ?a3 D? ?a3 D? ?a2 A? ? ?a1 A? ? ?a2 D? ?a5 A? ?a4 A? ?a5 15.6 D−b 2A? ??b2 D−b3 B−b4 D−b1 C−b3 B−b1 C−b2C−b4 C−b1 B−b3 3.47 Figure 2. U-matrix (on left) and sample distribution map (on right) of SOM analysis ... Competing financial interests: The authors declare no competing financial interests How to cite this article: Zhang, Y et al A novel approach combining self-organizing map and parallel factor analysis
Ngày tải lên: 19/11/2022, 11:47
genepanda a novel network based gene prioritizing tool for complex diseases
... We assume that all gene- disease associations annotated by the GAD database are true associations, and select 196 diseases that have at least associated disease genes for prediction Disease-related ... already known disease genes and promising candidate genes using statistical methods For example, aBandApart19 and Gene Prospector20 both mine MEDLINE data to uncover candidate disease associated ... Xiaohui Wu1,3 & Weidong Tian1,2 Here we describe GenePANDA, a novel network-based tool for prioritizing candidate disease genes GenePANDA assesses whether a gene is likely a candidate disease gene
Ngày tải lên: 04/12/2022, 10:32
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and HRP-C (AAA33377) Residue numbers start at the putative mature proteins by analogy with HRP-C Preprotein ... Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana Gene 288, 129–138 Tanaka S, Ikeda K, Ono M & Miyasaka H (2002) Isolation of several anti-stress genes...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot
... anomaly modeling, we generated a variety of anomaly attack data such as covert channels, malformed packets, and some DoS attacks The simulated attacks were included in one of following five categories, ... training dataset had only normal traffic because they had unlabeled learning ability In case of G-HMM, G-HMM made a normal behavior model using normal data, and then G-HMM calculated the ML values ... the total number of normal data The false negative rate is defined as the total number of attack data that were incorrectly classified as normal traffic divided by the total number of attack data 7.1...
Ngày tải lên: 21/06/2014, 05:20