a norwegian fiord as a natural gradient of metal contamination
the nothing that is, a natural history of zero - robert kaplan
Ngày tải lên :
05/06/2014, 11:23
... vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati (1047) to tallakchana (107 ... Archimedean spirit) A seven-yearold of my acquaintance claimed that the last number of all was 23,000 'What about 23,000 and one?' she was asked After a pause: 'Well, I was close.' Under this Adam ... must name all the numerical ranks beyond a koti (ten million, i.e., 107), each rank being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha,...
- 238
- 5.2K
- 0
Báo cáo lâm nghiệp: " Mating system parameters in a natural population of Abies borisii regis Mattfeld" pdf
Ngày tải lên :
08/08/2014, 18:21
... which is a limitation for intercrossing, similar val= recorded for other Abies: A alba, = 0.89 (Schroeder, 1989); A lasiocarpa, m t m t 0.89 (Shea, 1987); A balsamea, t m 0.89 (Neale and Adams, 1985) ... dissertation, Oregon State University Ncale DB, Adams WT ( 1981 ) Inheritance of isozyme variants in seed tissues of balsam fir (Abies balsamea) Can J Bot 59, 1285-1291 Neale DB, Adams WT (1985) Allozyme ... Allozyme and matingsystem variation in balsam fir (Abies balsamea) across a continuous elevational transect Can J Bot 63, 2448-2453 Ritland K (1986) Joint maximum likelihood estimation of genetic and...
- 5
- 234
- 0
báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc
Ngày tải lên :
12/08/2014, 03:21
... Department of Biology and Wildlife, University of Alaska at Fairbanks, Fairbanks, AK 99775, USA 3Institute of Arctic Biology, University of Alaska at Fairbanks, P.O Box 757000, Fairbanks, AK ... among 331 offspring is comparable to 4% of nonmaternal offspring revealed among 318 S vulgaris plants by [22] Rare paternal inheritance (1.9%) of mt markers in a natural population of S vulgaris ... the cox1 gene and internal primers were developed to sequence the atp1 gene (AtpA297F: TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding...
- 11
- 163
- 0
Báo cáo sinh học: "Association among quantitative, chromosomal and enzymatic traits in a natural population of Drosophila melanogaster" pptx
Ngày tải lên :
14/08/2014, 19:22
... outstanding features of natural southern and northern populations of the species for these same characters MATERIALS AND METHODS A sample of 359 males and 259 females of Drosophila melanogasterwas ... Drosophila melanoto latitude, season, wing-loading Tantawy AO, Mallah GS (1961) Studies on natural population of Drosophila I Heat resistance and geographical variation in Drosophila melanogaster and D ... D melanogaster J Genet 50, 414-448 Ruiz A, Santos M, Barbadilla A, Quezada-Diaz JE, Hasson E, Fontdevila A (1991) Genetic variance for body size in a natural population of Drosophila buzzatii...
- 20
- 350
- 0
Báo cáo sinh học: "Seasonal fluctuations of cosmopolitan inversion frequencies in a natural population of Drosophila melanogaster" pot
Ngày tải lên :
14/08/2014, 20:20
... Japanese natural populations of Drosophila melanogaster Jpn J Genet 54, 69-82 Inoue Y, Watanabe T, Watanabe TK (1984) Evolutionary change of the chromosomal polymorphism in Drosophila melanogaster ... time, D melanogaster populations survive as adult flies that can withstand, for nearly 200 days, temperatures close to 10°C (Lumme and Lakovaara, 1983; David et al, 1983) As Drosophila development ... due to the small scale of sampling (Anderson et al, 1987) The parallel chromosomal changes with latitude suggest an adaptation to ecological differences associated with climate (explanations involving...
- 10
- 199
- 0
Carpets monsters and killer spores: a natural history of toxic mold
Ngày tải lên :
27/05/2016, 00:05
... species that may someday replace Stachybotrys & Company as the new menace, a cash cow for the legal profession and a bane of insurers These beasts will be featured in the final chapter The target audience ... characteristic of Stachybotrys At the time, the study did not attract a lot of attention It served as another example of the diverse relationships between humans and fungi, and was viewed as an ... imparts an air of brilliance that will persuade a hapless homeowner that their security is assured by the hands of a master Humidity measurements can be useful from different areas of a home because...
- 191
- 330
- 0
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf
Ngày tải lên :
24/03/2014, 05:21
... property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial ft~%ctional-equation and by ... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For ... predicates which are goals ca~ give infon~tion to their subgoals In short, once a phrase structure grammr has been translated into a PROIOG pragraune every node is potentially able to grasp information...
- 6
- 476
- 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor
Ngày tải lên :
12/09/2015, 08:20
... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 ... Increase FA oxidation Increase FA uptake FA Hepatocyte CD36 FATP-1 L-FABP Mitochondria Brain, β-oxidation Acetyl-CoA FA HMGCS2 Acyl-CoA synthetase Acyl-CoA dehydrogenase Muscle as energy CPT 1A FA...
- 263
- 267
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
Ngày tải lên :
26/10/2012, 10:03
... Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure PROC GENMOD (SAS ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... Sickness absence can be viewed as an integrated measure of physical, psychosocial, and social function and wellbeing [5-7] As such, sickness absence levels can reflect an increased risk of developing...
- 6
- 578
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
Ngày tải lên :
13/04/2013, 10:29
... managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations Brand Personality PRODUCT Country of ... (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities of ... has paid attention to it The Company has an unclear management information system and lack of retailers and consumers database to manage the distribution network Nevertheless, the Company has...
- 67
- 974
- 0
A contrastive analysis of encouraging as a speech act in english and vietnamese
Ngày tải lên :
26/11/2013, 13:31
... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication ... emergence of English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, ... describes and analyzes the syntactic and pragmatic features of 2.2.2.2 Classifications of speech acts directives in English and Vietnamese Searle (1975) has set up the following classification of Trương...
- 13
- 1.6K
- 8
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc
Ngày tải lên :
12/02/2014, 17:20
... G.W .A Milne, EPA/NIH Mass Spectral Data Base, U.S Government Printing Office, Washington D.C., 1978, 1980, 1983 [5] E Stenhagen, A Abrahamsson, F.W McLafferty, Registry of Mass Spectral Data, ... 0.25 µm) The analytical condition were the same as described above with He as carrier gas, and interface temperature 260o C Components identification was carried out by comparing MS data with those ... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora,...
- 4
- 403
- 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf
Ngày tải lên :
20/02/2014, 18:20
... information about the semantic structure of concepts associated with English words, particularly verbs For example, the verb abridge has an associated case frame consisting of an agent doing the abridging ... straightforward, and the resulting complex of resources executes without any performance problems in a multi-user environment The task of a developer of a particular natural language application is greatly ... client-server architecture, for use with a general-purpose natural language understanding system The conversion of resources such as Comlex and WordNet into a format usable by our system was straightforward,...
- 5
- 416
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
Ngày tải lên :
05/03/2014, 15:20
... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
- 14
- 610
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
- 12
- 454
- 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf
Ngày tải lên :
06/03/2014, 04:20
... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at ... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... patient with tuberculous bronchopneumonia, was able to maintain oxygen saturation (SaO2) of 96% at room air, while patient with tuberculous pneumonia in case was able to maintain SaO2 of 90% at...
- 7
- 352
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
Ngày tải lên :
07/03/2014, 02:20
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... cytoplasm of z-IETD-treated cells (Fig 5A, panels 22–24) Thus, inhibition of caspase-8 activation does not affect the initial nuclear–cytoplasmic translocation of FADD; however, FADD relocalization...
- 10
- 483
- 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf
Ngày tải lên :
07/03/2014, 03:20
... regions has also suggested that NF-jB might be regarded as a signal transducer that transmits transient synaptic signals to the nucleus and has a role in behaviour, learning and memory formation ... kinase A ⁄ CREB signalling Mol Cell Biol 26, 2936–2946 Kassed CA, Willing AE, Garbuzova-Davis S, Sanberg PR & Pennypacker KR (2002) Lack of NF-kappaB p50 exacerbates degeneration of hippocampal ... A, Benarese M & Spano PF (2005) Inhibition of IkappaBalpha phosphorylation prevents glutamate-induced NF-kappaB activation and neuronal cell death Acta Neurochirurgica Suppl 93, 59–63 Aleyasin...
- 9
- 527
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating...
- 9
- 634
- 0