... to read what a visitor has entered into a form, perform a mathematical calculation based on the input, and provide feedback by displaying the results in another part of the form You may not find ... Each chapter will cover at least one new application If you want a preview of what you’ll learn, read the first page or so of each chapter What Are the Alternatives to JavaScript? Several other ... advent of Ajax Ajax is a concept that makes even a few professional programmers’ heads spin, but (not surprisingly) Dave manages to break down what Ajax is and what it isn’t, explains when it makes...
Ngày tải lên: 28/04/2014, 16:58
... JavaScript’s ability to read what a visitor has entered into a form, perform a mathematical calculation based on the input, and provide feedback by displaying the results in another part of the ... Each chapter will cover at least one new application If you want a preview of what you’ll learn, read the first page or so of each chapter What Are the Alternatives to JavaScript? Several other ... Java Although JavaScript and Java have similar names, they aren’t the same Netscape initially created JavaScript to provide interactivity for Web pages, and Sun Microsystems wrote Java as a general...
Ngày tải lên: 28/04/2014, 16:58
Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx
... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J .A Bondy and U.S.R Murty, Graph Theory ... vertices, and (G) denote the number of edges In this paper, we construct a graph G having no two cycles with the same length which leads to the following result Theorem Let t = 27720r + 169 (r ≥ 1), then ... the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou Teachers...
Ngày tải lên: 07/08/2014, 06:22
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... that despite the fact that they are regular visitors of both restaurant, they did not take note of that particular attribute on their various visit and as a result had nothing to say about it An ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...
Ngày tải lên: 24/09/2012, 17:19
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also that the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...
Ngày tải lên: 05/09/2013, 14:58
A Pragmatic Introduction to the Art of Electrical Engineering
Ngày tải lên: 04/11/2013, 10:15
Focus - A simplicity manifesto in the Age of Distraction
... is the computer, with email notifications and other notifications of all kinds Then there’s the addicting lure of the browser, which contains not only an endless amount of reading material that ... facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what the results are In most cases the actual harm will be much less than ... half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse, you now know the value of disconnecting,...
Ngày tải lên: 05/01/2014, 15:25
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... and tools The knowledge management strategy developed at Irizar At Irizar, it is understood that the objective of KM is the promotion of innovation and the capacity of the organization to transform ... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... knowledge of the environment, markets and customers The second fundamental aspect in the Irizar strategy was that of shared leadership The idea that the best organizations not depend on great...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, ... protocol by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis As such, a score of denotes no available evidence ... in remainder of study (Phase 2) Parents assessed same dimensions on a parent version of questionnaire, as well as questions about general health Aged 2-4 yrs at diagnosis Diagnosed via mass screening...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... socio-economic groups be addressed? V.8 V.8.1 A coherent and comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming ... theoretically preventable cause of cancer Consumption of adequate amounts of fruits and vegetables, and physical activity, appear to be protective against certain cancers Body weight and physical inactivity...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... was America The role of World War I and the breakdown of the classical gold standard was taken over by the Cold War and the breakdown of the Bretton Woods System The latter’s replacement by a ... bonds, the U.S corporate bond market was several magnitudes larger than that of any other country It was no accident of history, then, that Moody, the originator of the bond-rating agency, was an American, ... slowly and then gathered steam as the early entrants became larger and new entrants appeared Such parallels between the two periods of agency expansion suggest to a historian that similar forces may...
Ngày tải lên: 16/02/2014, 03:20
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... θ(ρ) and therefore on the movement of all the other particles In the present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other ... z, and (2.6) At any site z at which the particles in σ (2) have type A, the particles also have type A in σ (1) Let A (·, ρ) be the random-walk paths associated to the various particles and ... broken in the same way as here, but we shall not mention ties or the breaking of them anymore Note that no extra B-particles are introduced at time 0, but that 708 HARRY KESTEN AND VLADAS SIDORAVICIUS...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... frequently the cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable ... impairs the quality of the milk The rapid determination of acidity may be made in an approximate manner so as to serve as a test at the weigh-can or intake The test is best made by the use of the ... of mineral matter The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... operating what might be described as a “floor system.” These are the ECB, the Bank of Japan, the Bank of England, the Bank of Canada, and Norges Bank The remaining central banks— the Reserve Bank ... Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European...
Ngày tải lên: 17/02/2014, 03:20
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... negotiation takes place that consists of rejection of offers by the apathetic individuals until the manager creates an exchange that is worthy of attention Many social managers are equally presumptuous ... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes of strategic ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Regulatory Rights Supreme Court Activism, the Public Interest, and the Making of Constitutional Law doc
... “‘reasonably unreasonable.’” 154 Scalia explained, however, that the awkward idea of being reasonable and unreasonable at the same time is a function of the “circumstance that the Fourth Amendment’s ... professor of law and the Basil Yanakakis Research Scholar at Boston University School of Law He has taught and written about constitutional law throughout his academic career, and he is the author ... Amendment, the warrant’s existence was sufficient to make the search “reasonable,” notwithstanding its lack of specificity The agent had told the magistrate what he was after, the magistrate had...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara S & Miura T (1999) Positive and negative regulation of the human ... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic ... HepG2 and HeLa cells were cultured for 48 h under normoxia or hypoxia, and then harvested The microsome fraction was prepared and used for the assay of HO activity The data are means ± SEM of three...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... change in the production pattern By coregulating PK and LDH cells can maintain homolactic fermentation The fact that the effects of PK and LDH almost cancel each other out may also add to the...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary of ... often deliver sub-optimal results Fortunately, the problem of matrix sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability ... items and means no similarity The vertical axes has no special meaning Only the order of the words is chosen in such a way that line crossings are avoided when connecting clusters As we can see, the...
Ngày tải lên: 20/02/2014, 16:20
Physics of the Impossible: A Scientific Exploration into the World of Phasers, Force Fields, Teleportation, and Time Travel
... Whereas Faraday had superb experimental instincts but no formal training whatsoever, Maxwell, a contemporary of Faraday, was a master of advanced mathematics He excelled as a student of mathematical ... enters and exits the apparatus via two slits carved into the metamaterial By analyzing the angles at which the laser light is bent as it passes through the metamaterial, one can then verify that the ... and as a consequence his notebooks are full not of equations but of hand-drawn diagrams of these lines of force Ironically, his lack of mathematical training led him to create the beautiful diagrams...
Ngày tải lên: 05/03/2014, 16:15