a news site with an api

... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... Isolation and chemical identication of trypsinogen from human brain Different antihuman trypsinogen mAbs were raised separately against recombinant human trypsin (mAb B1, mAb B7) and the 28-amino...

Ngày tải lên: 07/03/2014, 10:20

... update the database report any errors test the non-Ajax version extra bits adding records via Ajax what we’ll add the Ajax elements apply the Ajax layer set up the Ajax prepare the form data complete ... can’t take advantage of Ajax (because their browser doesn’t support JavaScript and XMLHttpRequest) Creating an Ajax-enabled application that will still function for non-Ajax-enabled browsers is a ... XMLHttpRequest object, make the ajax variable an object of that type (See extra bits on page 39.) Most Web browsers—Apple’s Safari 1.2 and later, Mozilla and Firefox, Opera and later, and newer versions...

Ngày tải lên: 27/03/2014, 13:38

... clear urine via Figure fat saturation and gadolinium enhancement T1-weighted coronal magnetic resonance imaging scan with T1-weighted coronal magnetic resonance imaging scan with fat saturation ... differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was likely to be an abscess rather than a tumour Again no ... T2-weighted (fluid)magneticmass (arrows) with scan showing T2-weighted axial magnetic resonance imaging scan showing a high-signal (fluid) cortical mass (arrows) with an irregular low-signal capsule The...

Ngày tải lên: 11/08/2014, 21:22

Ngày tải lên: 29/08/2016, 20:04

Ngày tải lên: 29/08/2016, 20:23

... tyrosinase gene Mepa J Bacteriol 175, 5403–5410 11 Lopez-Serrano D, Sanchez-Amat A & Solano F (2002) Cloning and molecular characterization of a SDSactivated tyrosinase from Marinomonas mediterranea ... Omura S, Ikeda H, Ishikawa J, Hanamoto A, Takahashi C, Shinose M, Takahashi Y, Horikawa H, Nakazawa H, Osonoe T, et al (2001) Genome sequence of an industrial microorganism Streptomyces avermitilis: ... processes In any case, many of the bacteria that express PPO activities are strains that interact with plants such as Rhizobium meliloti [10], Ralstonia solanacearum [17] and the marine epiphyte...

Ngày tải lên: 19/02/2014, 07:20

... of our actions 1.2.3 Integrated management and policy analysis Integrated management Rapid changes of objectives and methodological approaches towards the management of natural resources and environment ... formulation, which aims at identifying, analyzing and evaluating management strategies, is that of policy analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and ... like a river or an estuary to a complete water system such as a river basin or a coastal area These changes result in integrated coastal-zone management, integrated river basin management and/or...

Ngày tải lên: 06/11/2012, 10:35

... Heat and Mass transfer conference, Jan12-14, Pune, 2000 [23] Zhang, Y M., Gu, W Z and Han, J C., “Heat transfer and friction in rectangular channels with ribbed or ribbed-grooved walls”, Trans ... in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han J.C Turbulent Heat transfer and friction in a square ... JNTU Hyderabad, India [22] Tariq, A. , Keshav Kant and Panigrahi, P K., “Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference...

Ngày tải lên: 05/09/2013, 16:10

... ways to synchronize a DataSet with an XmlDataDocument: Method Populate a DataSet with both schema and data Synchronize it with a new XmlDataDocument, initializing it with the DataSet in the constructor ... Populate a DataSet with a schema but no data Synchronize it with a new XmlDataDocument, initializing it with the DataSet in the constructor Load an XML document into the XmlDataDocument The table ... synchronous access to both a DataSet and its XML representation in an XmlDataDocument object The synchronized DataSet and XmlDataDocument work with a single set of data The solution shows three ways...

Ngày tải lên: 21/01/2014, 11:20

... [38] or anti-HA (Sigma) Gels were dried and autoradiographed using Phosphorimager Storm Band intensities on the gels were quantified with image-quant software Average values and standard errors ... Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function Pathol Int 50, 589–593 23 Levrero M, De Laurenzi V, Costanzo A, Gong J, Wang ... AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug cisplatin Nature 377, 649–652 29 Zlatanova J, Yaneva J & Leuba...

Ngày tải lên: 19/02/2014, 05:20

... in a time-dependent enhancement of the 57-kDa band with a concomitant diminution of the 38-kDa and 19-kDa bands, as analyzed by SDS ⁄ PAGE (Fig 3A) The 38-kDa and 19-kDa bands did not disappear ... fact that the D16 4A mutant of kumamolisin remains an inactive 57-kDa precursor, with His172p located at P1 and unable to assist autocatalytic activation [6] The pH-dependences of kcat and kcat ... Wlodawer A, Li M, Gustchina A, Tsuruoka N, Ashida M, Minakata H, Oyama H, Oda K, Nishino T & Nakayama T (2004) Crystallographic and biochemical investigations of kumamolisin-As, a serine-carboxyl...

Ngày tải lên: 19/02/2014, 07:20

Ngày tải lên: 05/03/2014, 16:20

... GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... used as a template The following oligonucleotides were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); ... AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A forward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A FEBS Journal 273 (2006)...

Ngày tải lên: 07/03/2014, 12:20

... polyadenylation signal AAUAAA [21] Analysis of the 3¢ end polyadenylation sites of the H-strand encoded RNAs by cDNA sequencing, has revealed that the putative polyadenylation signal, AAUAAA, is conserved ... AAUAAA [20] This canonical nuclear polyadenylation signal is believed to have a role in the 3¢ end formation of nuclear RNA polymerase II transcripts and also yeast mt mRNAs [21,22] Similar A/ T-rich ... helping with the illustrations and M Higgins for editorial assistance This research was supported in part by NIH grant GM49683 and Common wealth and General Assembly of Pennsylvania grant awarded...

Ngày tải lên: 08/03/2014, 08:20

... also aim to recycle sentence fragments where possible, as we Work on phrasebased statistical machine translation has been applied to paraphrase generation (Bannard and Callison-Burch, 2005) and ... Empirical Methods in Natural Language Processing and Computational Natural Language Learning, Prague, Czech Republic J Edmonds 1967 Optimum branchings J Research of the National Bureau of Standards, ... international conference on Natural language generation, Morristown, NJ, USA Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Proceedings of the 43rd Annual...

Ngày tải lên: 24/03/2014, 03:20

... TIGUKAT (tee-goo-kat) is a term in the language of Canadian Inuit people meaning “objects.” The Cana- dian Inuits, commonly known as Eskimos, are native to Canada with an ancestry originating ... say with respect to a paragraph Then, after an edit, the only annotations that change are the annotations of the sub-elements in the edited paragraph and the annotations of all following paragraphs ... media, and (Gibbs et al 1993) deals with so-called audio/video (AV) databases These databases are collections of digital audio/video data and processes which can 37 compose and aggregate these data...

Ngày tải lên: 30/03/2014, 22:20

... Engineering, 6(1):1–18 [Manousopoulou et al.1997] A. G Manousopoulou, G Manis, P Tsanakas, and G Papakonstantinou 1997 Automatic generation of portable parallel natural language parsers In Proceedings ... Torisawa, and Jun’ichi Tsujii 2001 An agentbased parallel HPSG parser for shared-memory parallel machines Journal of Natural Language Processing, 8(1), January [Nurkkala and Kumar1994] Tom Nurkkala ... consists of two parts: MACAMBA and CaLi MACAMBA stands for Multi-threading Architecture for Chart And Memoization-Based Applications The MACAMBA framework provides a set of objects that implement...

Ngày tải lên: 31/03/2014, 04:20

... health is a capital good produced via time and money and thus determines the amount of time available for market and non-market activities and the amount of income available to purchase non-health ... our survey was conducted in a Mediterranean country a natural candidate is the Mediterranean diet index Studies from the medical literature have long derived, used and validated such an index We ... 1, and persons whose consumption was at or above the median were assigned a value of Thus, the total Mediterranean Diet Score (GB) ranged from (minimal adherence to the traditional Mediterranean...

Ngày tải lên: 08/04/2014, 16:55

... Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions Editor: Megan Belanger Project ... control panels Assigning a User to the Database Every database must have a user assigned to it or authorized to use it After you create a database, you must associate a user with a username and password ... PHP 5.2.x and MySQL 5.0.4 Username and Password for Database After you have created the database, you must assign a username and password (U/P) that are unique to that database Joomla! needs this...

Ngày tải lên: 29/05/2014, 23:54