a new player in the initiation of dna replication
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
Ngày tải lên :
09/08/2014, 01:23
... can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in animal models and initial data ... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research ... 95 Arthritis Research & Therapy Vol No Haringman and Tak The data from studies with chemokine antagonists in humans are at present not very comprehensive However, the initial data are promising...
- 5
- 460
- 0
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
Ngày tải lên :
12/08/2014, 15:22
... has no competing interests Published: 27 April 2011 References Takei S, Hoshino T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa ... activity; the activation and release of IL-18 by the in ammasome as a marker of innate immunity; and the alternatively spliced soluble IL-18Rβ, which is mainly expressed in the lymphoid organs and ... the diagnosis of RA The soluble IL-18Rα complex as a biomarker may capture the complexity of the in ammatory process: the shedding of membrane IL-18Rα as a marker of enhanced proteolytic activity;...
- 3
- 294
- 0
A new direction in the study of the orientation number of a graph
Ngày tải lên :
12/09/2015, 21:07
... ie aj → B ∗ Th e n d( b∗ , aj ) ≤ fo r a ll b∗ ∈ B ∗ im p lie s B ∗ → a; a n d fo r a ll al ∈ A \ {aj }, d( al , aj ) ≤ im p lie s al → a Th is m e a n s t h a t A = {aj } a n d A = A \ {aj ... h a p t e r b y e xa m in in g t h e family o f g r a p h s ( r a t h e r t h a n ju s t a particular g r a p h ) o b t a in e d b y a d d in g p e d g e s b e t we e n Kp a n d Cp in a n a ... o t a c o -p a ir Fo r e a c h bi ∈ B, le t Si = O( bi ) ∩ A W e a ls o le t A = {ai |ai → a in F } a n d A = A \ A L ike wis e , B = {bj |bj → b in F }, B = B \ B , A = {ai |b → in F } a n...
- 226
- 350
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
Ngày tải lên :
21/02/2014, 01:21
... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... (6.5%) Thus, the alanine and glycine Fig Anion exchange-HPLC elution profiles of the water-soluble matrix (A) and the EDTA-soluble matrix (B) of Pinctada maxima nacre Samples (55 lL) containing 400...
- 10
- 731
- 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
Ngày tải lên :
07/03/2014, 21:20
... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... constitute the minimal transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain ... distribution (Fig 1), in which the SPP1 representatives are at the basal branch of CGBP and DIO The GCBP proteins contain a PHD domain, followed by a DNA- binding domain (the zf-CXXC) and the newly described...
- 7
- 658
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
Ngày tải lên :
11/08/2014, 20:21
... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... the gelatin block was evaluated After the centre of the gelatin block had been determined, the mean diameter of the permanent cavity was identified To this end, the length of the permanent cavity ... significant differences between the size of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in...
- 5
- 573
- 0
Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf
Ngày tải lên :
14/08/2014, 14:21
... Hatfield GW, Baldi P: Improved statistical inference from DNA microarray data using analysis of variance and a Bayesian statistical framework Analysis of global gene expression in Escherichia ... contains a self-hybridization The VSG interaction contains variances due to hybridization and sampling Some factors are confounded Due to the fact that in our DNA- microarray laboratory validation ... culturing, (ii) cell pelleting and RNA isolation, (iii) cDNA labeling, and (iv) hybridization, scanning, image- and data analysis Figure Sammon projection of the clustering of validation data using...
- 35
- 274
- 0
Extending past research in extra role behavior unleasing a new paradigm from the prism of knowledge sharing and whistleblowing
Ngày tải lên :
12/09/2015, 11:24
... political affairs and holds that craft and deceit are justified in pursuing and maintaining political power Even today the word is still in the English language meaning of or relating to Machiavelli ... Srivastava, 2003; Smith, 2001) the real challenge, success and a fundamental premise of knowledge management today is in its ability to facilitate information sharing Investing substantial capital ... demonstrated that person-by-situation interaction effects could explain a substantial amount of variance over and above either personality or situational variance taken separately From a theoretical...
- 217
- 492
- 0
Focus - A simplicity manifesto in the Age of Distraction
Ngày tải lên :
05/01/2014, 15:25
... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... What blogs? What news? What other reading or watching or listening? What can you cut out? Can you cut half of the things you read and watch? More? Try eliminating at least one thing each day: a ... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what...
- 121
- 552
- 1
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Ngày tải lên :
08/03/2014, 18:20
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... phonologically an affix is syntactically a separate word n this is the case with cliticization Having found the possible morphemes, we have a lattice of morphemes spanning the input In the example case, ... morphological processing to encode these notions We view the parsing system as a partial but general theory of morphological processing, and the work we have done on Warlpiri as a particular instantiation...
- 8
- 522
- 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf
Ngày tải lên :
09/03/2014, 01:20
... candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the modifier are ... alternatives called grammatical features The semantic interface of the Nigel grammar is defined by a set of inquiries that control choices of grammatical features by mediating the flow of information ... multi-level transfer is an SPL representation of the English translation of the original German sentence, which may then drive generation by Penman as in any other application domain The translation...
- 9
- 680
- 1
New Directions in the History of Nursing pot
Ngày tải lên :
22/03/2014, 15:20
... juxtaposes traditional masculine values with a disturbing incursion of the feminine In Britain since the Crimean war and in the USA since the Civil War (also known as the War Between the States), ... McGann, The Battle of the Nurses 88 A welcome essay examined one aspect of the career of an in uential figure in German nursing, Agnes Karll A thorough examination of the careers of Karll and other ... questions about pioneers are as important as innovative accounts that are pushing out the boundaries in new areas of investigation One of the dilemmas of the history of any profession remains for the...
- 224
- 433
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
Ngày tải lên :
28/03/2014, 23:20
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
Ngày tải lên :
30/03/2014, 04:20
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... migration of the DNA standard (B) PCR ready cDNA from human fetal brain, human adult brain, human adult hippocampus, amygdala and cerebral cortex were used as templates in PCR reactions with the Cb...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
Ngày tải lên :
31/03/2014, 01:20
... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical ... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There...
- 7
- 322
- 0
new developments in the chemistry of war gasses 1950
Ngày tải lên :
09/05/2014, 17:01
... chains, and branching of the chain at the carbon atom adjacent to the oxygen appears to confer higher toxicity than branching at the end of the chain (b) Replacement of the fluorine atom by another ... crystals, the rate of formation of which increases with an increase in temperature Changes in the length of the alkyl chain R and the presence of solvents have also a large effect on the rate of the ... practically equal reactivity toward the amino groups of amino acids and of peptides )2’ ,2”-Trichlorotriethylamineseems to have a greater reactivity toward the p-amino group of p-alanine and toward...
- 33
- 475
- 0
a new dataset in the making
Ngày tải lên :
02/06/2014, 09:22
... Justin Leinaweaver, Julie Mandoyan, Martiño Rubal Maseda, Claudia Meier, Irina, Mirkina, Katharina Niedermayer, Livio Raccuia, Maria Rubi, and Kathrin Schwaller We are grateful for comments and suggestions ... Percentage 20 25 National treatment no National treatment yes Percentage America Oceania Region 30 Region Africa Europe Asia Africa America Oceania Region Cross Europe Asia Africa America Oceania ... from information available in the preamble and the remaining part of the agreement Accordingly, we code the type of issues addressed in the agreement In addition, we list related references to other...
- 47
- 414
- 0
coats & schauberger - nature as teacher - new principles in the working of nature (1998)
Ngày tải lên :
04/06/2014, 12:23
... Temperatures prevailing in the interior of the Earth are the product of interactions that take place between carbones contained in the Earth and oxygen entrained by infiltrating water Were the last ... and others reveal that an increased discharge of moults follows from an increased intake of water in the body, whereas a reduced intake of water results in a greater condensation of the same, and ... swimming in the middle were pressed so closely together that their fins stuck out of the water There it was again? The dark shadow of the eagle and the miniature maelstrom The eagle had one of the...
- 184
- 357
- 0
analytic theology new essays in the philosophy of theology apr 2009
Ngày tải lên :
10/06/2014, 21:53
... with the practical value of trying to theology in a way that conforms to the prescriptions that characterize analytic philosophical writing AGAINST ANALYTIC AMBITIONS In the opening paragraph of ... of the parable of the talents, the righteous judge, our companion in paradise, and the Ancient of Days seated on the throne of Wre Theorizing about God via conceptual analysis, as we in the analytic ... interpretations For, given the uniform treatment constraint, a mathematical interpretation of ‘Jesus is the Son of God’ would force at least a partially mathematical interpretation of (say) the Apostle’s...
- 327
- 341
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
Ngày tải lên :
21/06/2014, 20:20
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... reaction-diffusion theory , in the turbulent flow of a gas in porous medium and in the non-Newtonian fluid theory In the non-Newtonian fluid theory, the quantity p is the characteristic of the medium If p < 2, the ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp...
- 16
- 438
- 0