a new model for comprehensive caries prevention

Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

... Statistical Analyses Part One Functional Movement Screen Data was coded using Stata 8.0 For exploratory data analysis we used bivariate methods The primary hypothesis was assessed with multivariate analysis ... Environmental Occupational Health Unit, The College of Public Health, University of Arizona, Tucson, Arizona, USA References National Institute of Occupational Safety and Health (NIOSH): National Occupation ... Occupational Safety and Health) has advised that occupational screening programs are a priority research area The U.S Preventive Services Task Force has recommended specific guidelines to decide if a...

Ngày tải lên: 20/06/2014, 00:20

9 468 0
Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

... 2: Example of a simple grammar lattice All grammars generate a common lexicon for all the grammars) A Grammar Lattice as a Search Space for Grammar Induction a Rule generalization steps a c s ... constraint-based grammars for natural language specifically designed to enable learning from representative examples annotated with semantics We have presented a new grammar learning model and showed ... Discussion A practical advantage of our GARS model is that instead of writing syntactic-semantic grammars by hand (both rules and constraints), we construct just a small annotated treebank - utterances...

Ngày tải lên: 08/03/2014, 02:21

8 402 0
Team Risk Management: A New Model for Customer- Supplier Relationships doc

Team Risk Management: A New Model for Customer- Supplier Relationships doc

... Project Management Team Risk Management Principles 11 Team Risk Management Functions 12 Scenario Comparing Team Risk Management to Risk Management 17 Advantages of Team Risk Management 19 Answers ... Initiate Team* Identify Analyze Plan Track Control *Note:Team is used as an action verb 12 Team Risk Management Model The Team Risk Management model is shown below Each function has a set of activities ... that both can together, but that neither could alone Accept the philosophy that the team can arrive at better solutions than any individual––even the program manager––can alone 19 Advantages and...

Ngày tải lên: 23/03/2014, 23:21

30 521 0
Winning in the Relationship Era™A New Model for Marketing Success By Doug Levy pptx

Winning in the Relationship Era™A New Model for Marketing Success By Doug Levy pptx

... industry Additional results are available at www.relationshipera.com, and details of the Brand Sustainability Map research methodology are available at www.relationshipera.com/brand-sustainability/bsm-info/ ... old model of marketing from the Consumer Era within a new era—an era that calls for a fundamentally different marketing mind-set In recent years, with the rapid emergence of social media and almost ... shallow approach to trust as they employ a new model of marketing Changing Within a Model versus Creating a New Model Although businesses constantly evolve, most change happens within a fundamental...

Ngày tải lên: 27/06/2014, 23:20

29 351 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... titanate particles appeared in the permanent cavity along the bullet path The cavity was covered with barium titanate particles along the entire bullet path Analysis of the temporary cavity To analyze ... each block (GE Medical Systems, Lightspeed, USA) at 120 kV and 200 mA Analysis The data obtained were stored in a digital format (DICOM) and transferred to a personal computer for further analysis...

Ngày tải lên: 11/08/2014, 20:21

5 574 0
The future of finance a new model for banking and investment

The future of finance a new model for banking and investment

... removing many protectionist barriers Globalization flourished as markets opened up; new capital was made available to business with Latin America, Asia, and Central and Eastern Europe.1 A paradox of ... “qualitative” analysis that can be applied, and which would influence the rating, because, unlike a corporation, a CDO is simply a brass plate on a wall Unfortunately, CDO quantitative analysts and ... Remuneration Model Unsuitable Personal Behavior Conclusion CHAPTER Bank Capital Safeguards: Additional Capital Buffers and Reverse Convertibles Capital Issues in a Bear Market Looking for New Capital...

Ngày tải lên: 30/10/2014, 16:18

227 509 2
Beyond the three circles a new model for world englishes

Beyond the three circles a new model for world englishes

... well as the native speaker‟s „prerogative to control its standardisation‟ (Kachru, 1985:29-30) And as part of a wider Kachruvian paradigm (Canagarajah, 1999:180) that has shaped the agenda for ... 1985:29-30) And as part of a wider set of beliefs, a Kachruvian paradigm (Canagarajah, 1999:180) as it were, that has shaped the agenda for the treatment of the variation and pluricentricity that exists ... bilingual‟s grammar is formed through a negotiation of the various codes available and is an amalgamation of these various codes And a learner picks up as much as is necessary for the learner...

Ngày tải lên: 01/10/2015, 11:39

144 955 0
A New Model for Network Traffic Based on Alpha Stable Self similar ...

A New Model for Network Traffic Based on Alpha Stable Self similar ...

... , and M s is an the dispersion and the mean or median of the distribution alpha-stable random measure on R with Lebesque A random variable X that follows an alpha-stable control measure The new ... network traffic So the new model can provide comparing the simulation traces of the three models with great advantages in the future research the actual network data, it is shown that the new model ... is said that the new the alpha-stable distribution, and then a new model is model is better than the other models in fitting the actual advanced based on the LFSN processes In terms of packets...

Ngày tải lên: 14/11/2015, 08:03

5 432 0
Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

... comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, stem-cell-like neuroblasts have been detected that ... of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology and evolution [3] Parasites can directly ... populations Genetic variation has been reported in Daphnia for a vast number of traits such as size, aging, Page of behavior (for example, vertical migration, fish-escape behavior), morphology (for...

Ngày tải lên: 06/08/2014, 19:21

4 318 0
Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

... calcaneus and first metatarsal head The distance between the floor and the line in standing position between the markers on calcaneus and first metatarsal were added afterwards ND was calculated ... took part in data acquisition, made the statistical analysis and interpretation of data, and helped drafting the manuscript OS and HL took part in revising the manuscript critically for important ... Scatterplot showing the variation of navicular drop among female participants Scatterplot showing the variation of navicular drop among female participants Acknowledgements Foot and Ankle Research...

Ngày tải lên: 10/08/2014, 21:23

7 461 0
Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt

Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt

... 6(2): Dandona P, Aljada A, Chaudhuri A, Bandyopadhyay A: The potential influence of inflammation and insulin resistance on the pathogenesis and treatmentof atherosclerosis-related complications in ... Day Values are Mean ± SEM Figure activity against murine melanoma B16-F10 in C57BL/6 mice following TGIK administration via different routes of administration Antitumor Antitumor activity against ... as tumor necrosis factor-α and interleukin1, that can activate synovial fibroblasts and other cells to produce matrix metalloproteinases involved in the degradation of cartilage" [71] As Dinarello...

Ngày tải lên: 11/08/2014, 10:23

12 430 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt

... treatment of rheumatoid arthritis but not for OA due to its limited and short-term effectiveness Maintaining a balance in levels of IL-1β might be important as a treatment approach for OA, and agents ... research grant (RG3891 to CR) Author details Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294, USA 2Birmingham VA Medical Center, Birmingham, AL 35294, USA 3Division ... understand the targets of GTPs in general, and of EGCG in particular, in arthritic/OA animal models The use of GTPs may be better than EGCG as GTPs may have synergistic effects, are more stable and are...

Ngày tải lên: 12/08/2014, 17:22

2 338 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...

Ngày tải lên: 12/08/2014, 23:23

19 317 0
Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx

Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx

... inhaled APC can prevent or minimize primary or secondary lung damage when low tidal volumes are used for mechanical ventilation Abbreviations APC, activated protein C; ERK, extracellular-regulated ... injury in anaesthetised sheep Crit Care 2009, 13:R51 Kotanidou A, Loutrari H, Papadomichelakis E, Glynos C, Magkou C, Armaganidis A, Papapetropoulos A, Roussos C, Orfanos SE: Inhaled activated protein ... Abraham Critical Care 2010, 14:144 http://ccforum.com/content/14/2/144 Page of cytokines did not appear to be reduced after APC treatment In contrast, in at least one study, inhaled APC did...

Ngày tải lên: 13/08/2014, 20:21

2 391 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

11 716 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...

Ngày tải lên: 15/12/2013, 06:15

59 771 3
A new algorithm for enumeration of minimum cutsets of graph by branch addition

A new algorithm for enumeration of minimum cutsets of graph by branch addition

... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive...

Ngày tải lên: 03/01/2014, 19:35

6 545 0
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... Virtual Reality Modeling Language (VRML) and the associated "viewers" which are rapidly becoming a standard way for users to share "virtual worlds" across the World Wide Web Virtual World Authoring...

Ngày tải lên: 23/01/2014, 07:20

10 634 1
Tài liệu A New Era for Conservation docx

Tài liệu A New Era for Conservation docx

... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...

Ngày tải lên: 25/01/2014, 20:20

69 440 0
Tài liệu A Global Model for Regulatory Reform doc

Tài liệu A Global Model for Regulatory Reform doc

... Information Technology Agreement II … are countries on use of standards and SDoC US and EU have asked for talks leading to a signed agreement APEC World Trade Organizations surveying …… APEC has ... Declaration of Conformity option June 24, 1998 Model for Regulatory Reform One Standard feedback Designed once to internationally-accepted global standards Market Surveillance Product sample and ... Standard on what are the requirements and content of a Compliance Folder and a Declaration of Conformity Guidance on market surveillance methods that a government should consider Conform to administrative...

Ngày tải lên: 26/01/2014, 02:20

17 418 0
w