a new mode of authentication access using visual evoked potentials

Health and Quality of Life Outcomes BioMed Central Research Open Access A new measure of patient pot

Health and Quality of Life Outcomes BioMed Central Research Open Access A new measure of patient pot

... An instrument to measure patient satisfaction with healthcare in an observational database: results of a validation study using data from CaPSURE American Journal of Managed Care 2000, 6(1):70-76 ... presence of the data skew that is a typical characteristic of treatment satisfaction data As noted elsewhere [29], the magnitude of the ceiling effect and accompanying skew is greatest among scales ... importance of consumer satisfaction to the success of both health care services and pharmaceutical products, conceptual advances in the field have lead to a proliferation of satisfaction measures across...

Ngày tải lên: 20/06/2014, 15:20

13 279 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...

Ngày tải lên: 17/04/2013, 16:09

137 855 0
Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc

Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc

... designers at a motorcycle factory Next, identify a spokesperson who can present the group’s ideas in a class discussion Brainstorm about your answers and present them in any format that will communicate ... design of current motorcycles You need to collect information to make an informed decision about the type of motorcycle that will attract new riders After you collect and analyze the information, ... For example, you could present your answers through visual images, text, or a combination of both Activity 1.1: Designing a New Type of Motorcycle Use this page to write down your ideas for Activity...

Ngày tải lên: 17/01/2014, 09:20

4 304 0
Tài liệu Create a New SQL Server Database from Within Visual Studio .NET pptx

Tài liệu Create a New SQL Server Database from Within Visual Studio .NET pptx

... create a new database, it does give you an idea of where you can see various databases in your system Now you will learn how to create a database in VS NET You can open the Create Database dialog ... database-in this case, SHADRACH2-and then choose New Database Although both methods open the Create Database dialog box, the second method fills in the server name for you Fill in the name of ... database you want to create-in this case, Chapter2 Choose the type of security that you want to use with this database If your network is strictly a Windows 2000 network, you can leave this as...

Ngày tải lên: 21/01/2014, 12:20

3 461 0
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

... group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of tools and ... go hand-in-hand, posing a choice at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many ... Kollock, author of Social Dilemmas: The Anatomy of Cooperation, explains that, Social dilemmas are situations in which individual rationality leads to collective irrationality That is, individual rational...

Ngày tải lên: 18/02/2014, 00:20

67 893 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

... carried out with ouabain, a natural blocker of the Na+ pump and an inhibitor of palytoxin action, have provided interesting findings Through the partial inhibition of Na+ ⁄ K+-ATPase, and regardless ... Brismar H & Aperia A (2001) Ouabain, a steroid hormone that signals with slow calcium oscillations Proc Natl Acad Sci USA 98, 13420–13424 47 Aydemir-Koksoy A, Abramowitz J & Allen JC (2001) Ouabain-induced ... Na,K-ATPase alpha subunit Proc Natl Acad Sci USA 91, 2965–2969 50 Cantiello HF (1997) Changes in actin filament organization regulate Na+,K(+)-ATPase activity Role of actin phosphorylation Ann NY Acad Sci...

Ngày tải lên: 18/02/2014, 14:20

8 691 0
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf

Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf

... and in collaboration with others Many challenges and discontinuities lie ahead 34 A new era of sustainability is far from guaranteed and will require both leadership and urgency As Paul Polman, ... recovered and turned into a new revenue stream Enhanced brand reputation has also been an outcome of the program: in 2009, Nokia won the 'Green Company of the Year' award in India, a marketplace critical ... complexities of international markets As Jeffrey Swartz, CEO of Timberland, put it, “One huge barrier is the lack of clear standards, targets and policy.” At the same time, executives are also wary of...

Ngày tải lên: 18/02/2014, 21:20

36 556 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

... favored and favored regions of the Ramachandran ˚ plot and r.m.s.d values for bond and angle of 0.005 A and 1.37 ° as shown in Table References Table Data collection and refinement statistics of ... Shimomura T, Denda K, Kitamura A, Kawaguchi T, Kito M, Kondo J, Kagaya S, Qin L, Takata H, Miyazawa K et al (1997) Hepatocyte growth factor activator inhibitor, a novel Kunitz-type serine protease ... growth factors and proteinase inhibitors Biol Chem 380, 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- Crystal structure of the catalytic domain...

Ngày tải lên: 19/02/2014, 00:20

13 588 0
Life and Physical Sciences Research for a New Era of Space Exploration docx

Life and Physical Sciences Research for a New Era of Space Exploration docx

... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant ... Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant viii AERONAUTICS AND SPACE ENGINEERING BOARD RAYMOND ... database) Coupling the database with a genetic bank and repository of astronaut samples would ensure the availability of the maximal amount of data to address future investigations Because of...

Ngày tải lên: 05/03/2014, 11:21

47 606 0
Research Program of the Partnership for a New Generation of Vehicles doc

Research Program of the Partnership for a New Generation of Vehicles doc

... Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and the Department of ... Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering viii Acknowledgments The committee wishes to thank all of the members of ... Princeton, New Jersey Staff JAMES ZUCCHETTO, Director RICHARD CAMPBELL, Program Officer ALAN CRANE, Program Officer MARTIN OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON,...

Ngày tải lên: 06/03/2014, 15:20

134 467 0
A New Database of Financial Reforms pot

A New Database of Financial Reforms pot

... Database Country name Albania Ecuador Kenya Russia Algeria Egypt Korea Senegal Argentina El Salvador Kyrgyz Republic Singapore Australia Estonia Latvia South Africa Austria Ethiopia Lithuania ... Lithuania Spain Azerbaijan Finland Madagascar Sri Lanka Bangladesh France Malaysia Sweden Belarus Georgia Mexico Switzerland Belgium Germany Morocco Taiwan Bolivia Ghana Mozambique Tanzania Brazil Greece ... Greece Nepal Thailand Bulgaria Guatemala Netherlands Tunisia Burkina-Faso Hong Kong New Zealand Turkey Cameroon Hungary Nicaragua Uganda Canada India Nigeria Ukraine Chile Indonesia Norway United...

Ngày tải lên: 06/03/2014, 19:20

30 1,1K 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

... of a transient nature Our data suggest a sequential model of signaling in which CD95 receptor activation generates early signals at the plasma membrane that lead to the translocation of nuclear ... and cytoplasmic (lanes 3–8) fractions were prepared from total cellular lysates and were immunoblotted using antibody against FADD Effective separation of nuclear and cytoplasmic fractions was ... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade...

Ngày tải lên: 07/03/2014, 02:20

10 483 0
A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot

A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot

... example, still own large-scale sound stages, and maintain significant pre- and post-production facilities, all of which are also available for lease by outside companies.5 That said, as any given production ... competitive advantages in the form of increasing returns to scale and scope and positive agglomeration economies Such advantages are fundamental in maintaining the status of the region as the leading ... TE RNATI ONA L (ITA), 2001) Most of it is directed to Canada, Australia, Britain and Mexico, with Canada receiving 81% of the total The Monitor Company (1999) estimates that the total dollar loss...

Ngày tải lên: 07/03/2014, 15:20

19 703 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... green of Fig.2) amyAspka a- amylase amyAspnd a- amylase amyBacsp a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA00331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA33386 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499...

Ngày tải lên: 07/03/2014, 21:20

17 477 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

... project of man-machine communication called TIBAQ (Text-and-Inference Based Answering of Questions, cf (Haji~ov@ and Sgall, 1981)) with no pre-arranged data base and with the capacity of self-enriching ... (which is an adjectival word-ending, ambiguous among nominative and accusative singular masculine-inanimate, and nominative singular masculine-animate, thus representing the adjectival "normal form,'), ... Universfitatis C.aroli, nae: Slavica 2ra~ensia ~ Z.av

Ngày tải lên: 09/03/2014, 01:20

8 414 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard...

Ngày tải lên: 14/03/2014, 23:20

11 397 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... chromosomal DNA with primers RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTATTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢) RTEAyF was designed as ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT...

Ngày tải lên: 16/03/2014, 04:20

12 445 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... to favour a similar mode of binding for Ac-OPP and Ac-CoA Binding mode of CoA to thiolases oxidized or acetylated at Cys89 The structure of CoA-complexed Z ramigera thiolase, in which the catalytic ... aimed to analyse in detail, using X-ray crystallography and isothermal titration calorimetry, the factors that influence the productive mode of binding of a CoA substrate to the active site of biosynthetic ... referred to as Wat82, and Ne2(His348) This oxyanion hole binds the Ac-CoA thioester oxygen atom, facilitating the nucleophilic attack of the C2 atom of Ac-CoA to the carbonyl carbon atom of the acetyl...

Ngày tải lên: 16/03/2014, 04:20

13 473 0
Báo cáo khoa học: "A Re-examination of Query Expansion Using Lexical Resources" pptx

Báo cáo khoa học: "A Re-examination of Query Expansion Using Lexical Resources" pptx

... via utilizing wordnet and recognizing phrases In Proceedings of the 2004 ACM SIGIR Conference on Research and Development in Information Retrieval R Mandala, T Tokunaga, and H Tanaka 199 9a Ad ... performance Unlike previous studies, we are able to show that query expansion using only manually created thesauri can lead to significant performance improvement The main reason is that the axiomatic ... Zhai 2005 An exploration of axiomatic approaches to information retrieval In Proceedings of the 2005 ACM SIGIR Conference on Research and Development in Information Retrieval H Fang and C Zhai...

Ngày tải lên: 17/03/2014, 02:20

9 244 0
w