a new method of imputation in survey sampling

... level of trust, extent of role specialization, level of coordination or manage- ment, and level of feedback and information avail- able. When certain levels are reached among these variables, new ... blues—emotions are a way of thinking that co-evolved with the increasing sophistication of human group formation. Emotions provide a non- rational means of bonding, trusting, judging, and monitoring that ... computing and ad hoc knowledge sharing, Rheingold points to a vari- ety of new knowledge collectives, including Wikipedia, Amazon, OhmyNews, SourceForge, and Slashdot. Wikipedia is a particularly interesting experiment...

Ngày tải lên: 18/02/2014, 00:20

... subsidiaries Investing in training employees to manage sustainability Engaging in collaborations & partnerships Incorporating sustainability issues into discussions with financial analysts ... to advancing sustainability in the sector, with a unique insight in the views of CEOs and global leaders on what it will take to reach a new era of sustainability. Keith Barringer Global Managing ... relationships in emerging markets. Natura has adopted a business strategy of investing in a new product platform based on the sustainable use of natural resources and respect for regional and...

Ngày tải lên: 18/02/2014, 21:20

... [1]. As a DD-containing and death effector domain-containing proapoptotic adaptor molecule, FADD is essential to recruit the initiator caspases-8 and -10 to instigate formation of the death- inducing ... compartmentalization of FADD as a novel regulatory mechanism in death receptor signaling. Abbreviations BFA, brefeldin A; DAPI, 4Â,6-diamidino-2-phenylindole; DD, death domain; DISC, death-inducing signaling ... endosomes and cas- pase activation, our data indicate that CD95 triggering induces additional, plasma membrane proximal signals. The elucidation of the molecular pathways involved in connecting CD95...

Ngày tải lên: 07/03/2014, 02:20

Ngày tải lên: 23/06/2014, 01:20

Ngày tải lên: 09/08/2014, 03:24

... nóng ẩm quanh năm. Độ ẩm trung bình hằng năm từ 80 – 90 %. Thời tiết hai m a m a, nắng. M a m a kéo dài từ tháng tư đến tháng mười. Lượng m a dồi dào, 90% lượng m a tập trung vào m a m a. ĐBSCL ... thông qua các tài liệu có được c a các tác giả đi trước, qua thực tiễn lời ăn tiếng nói hằng ngày c a người dân đ a phương, luận văn nhằm tìm hiểu về định danh từ vựng c a PNNB, đ a ra những ... niệm “sự cố định (hay gắn) cho một kí hiệu ngôn ngữ một khái niệm – biểu niệm (signifikat) phản -47- đ a lí tự nhiên Nam Bộ mà chúng ta đang quan niệm hiện nay. Đây cũng là quan điểm trong việc...

Ngày tải lên: 17/04/2013, 16:09

... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and ... (data not shown), indicating that the cells maintained the physiological characteristic of acetylated-LDL uptake. Lyve-1-positive liver sinusoidal endothelial cells in vitro Intriguingly, almost...

Ngày tải lên: 18/02/2014, 17:20

... ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma Nannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong and Hua ... PPP6C antisense as above; b-actin sense, 5Â-CGTGAC- ATTAAGGAGAAGCTG-3Â; and b-actin antisense, 5Â-CT- AGAAGCATTTGCGGTGGAC-3Â. PCR cycles were as follows: 94 °C for 5 min, followed by 40 cycles at...

Ngày tải lên: 14/03/2014, 23:20

... to maintain the mass-44 ion beam at a current of 160 nA. Each analysis in- volves 10 cycles of sample-standard comparison and each cycle involves 8 s integration of sample and standard ion beams. ... maintain a constant isotopic composition of solution during experiments or between sampling and final analyses; and analytical errors in deter- minations of the d 18 O of water and carbonate. All ... with our inorganic calcite calibration curve indicates several important things about the analysis of D 47 values in nat- ural carbonates: ã First,aragoniteandcalcite appear toexhibitthesamerela- tionship...

Ngày tải lên: 22/03/2014, 18:20

... containing various amounts of AdK (0.1–4.0 nmol in a final volume of 0.25 mL) and a fixed amount of MK (0.0008 nmol) in the absence of ADA. Inset: Scatchard plot. D. Vannoni et al. Formation of ADP ... revealed the disap- pearance of ADP and the formation of an ATP peak, which was identified in the chromatogram using the same criteria as for ADP and inosine. CE analysis All of the above compounds ... mechanism involves the association of adenosine kinase and myokinase through non-covalent, transient interac- tions that induce slight conformational changes in the active site of myokinase, bringing...

Ngày tải lên: 23/03/2014, 06:20

... enthusiasm of Cardinal Manning, head of the Catholic Church in England, for the Vatican Council’s defin- ition of Papal Infallibility in 1870. Nonetheless, he was in 1879 made a cardinal by Pope ... church, and acquired a lasting fame as a preacher. After an evangelical upbringing he became convinced, over the years, of the truth of the Catholic interpre- tation of Christianity. He was one of ... Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by SPI Publisher Services, Pondicherry, India Printed in Great Britain on acid-free paper by Biddles...

Ngày tải lên: 11/06/2014, 10:25

... resuspended in PBS (Gibco – Invitrogen, Carlsbad, CA) at a concentration of 1.0 ì 10 5 cells/mL and stained with saturating concentration of antibodies. After 45 minute incubation in the dark at room ... Carlsbad, CA) in plastic flasks (25 cm 2 ), and maintained in a humidified atmosphere of 5% CO 2 in air at 37°C. The culture medium used for expansion was initially changed every 72 hours and ... mesenchymal nature of the isolated cells and their multipotency. Population doubling and karyotypic analysisFigure 2 Population doubling and karyotypic analysis. Panel A) Results of hFTs lineage in passage...

Ngày tải lên: 18/06/2014, 15:20

... data workup, statistical analysis and drafted the manuscript, VS was involved in technical assistance and in writing the manuscript, HD carried out H&E staining and CK19 IHC, CS coordinated ... staging of lymph atic metastases in CRC and enables the examination of whole LN. It can be applied as a rapid diagnostic tool to estimate tumo ur involvement in LN during the staging of CRC. Introduction Carcinomas ... This scenario suggests that Haema- toxylin and Eosin staining (H&E) as the current method applied to assess the nodal status of CRC patients may not be fully adequate. Small metastases (<5...

Ngày tải lên: 18/06/2014, 16:20

... Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y: Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar ... identification and bioinformatics characterization of an intein in the DNA polymerase PolB gene of amoeba infecting Mimivirus, the largest known double-stranded DNA virus, the origin of which has been ... remotely related organisms. Proc Natl Acad Sci U S A 1997, 94:7851-7856. 21. Tajima K, Nagamine T, Matsui H, Nakamura M, Aminov RI: Phyloge- netic analysis of archaeal 16S rRNA libraries from...

Ngày tải lên: 18/06/2014, 22:20

... Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y: Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar ... Variola virus, Asfarvirus, eukaryotic DNA polymerase α and δ catalytic subunits, and archaeal DNA polymerase I. Intein containing genes are indicated by bold letters in the figure. Numbers in ... remotely related organisms. Proc Natl Acad Sci U S A 1997, 94:7851-7856. 21. Tajima K, Nagamine T, Matsui H, Nakamura M, Aminov RI: Phyloge- netic analysis of archaeal 16S rRNA libraries from...

Ngày tải lên: 20/06/2014, 04:20

... Applications in Nonlinear Analysis. Marcel-Dekker, New York 24. Verma, RU: Iterative algorithms and a new system of nonlinear quasivariational inequalities. Adv. Nonlinear Var. Inequal. 4(1), 117–124 ... by V IP (A, K), is to find x ∗ ∈ K such that Ax ∗ , z − x ∗  ≥ 0 for all z ∈ K. The variational inequality has emerged as a fascinating and interesting branch of mathematical and engineering sciences ... and quasiconcave on B for all a ∈ A, then inf a A max b∈B p (a, b) = max b∈B inf a A p (a, b). Definition 2.6 (KKM mapping). Let K be a nonempty subset of a linear space E. A set-valued mapping G...

Ngày tải lên: 20/06/2014, 21:20

... Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters Cheng-Han Chan, 1 Soo-Chang Pei (EURASIP Member), 2 and Jong-Jy Shyu 3 1 Department of Aviation and ... Communication Electronics, Air Force Institute of Technology, Kaohsiung 820, Taiwan 2 Department of Electrical Engineering, National Taiwan University, Taipei 106, Taiwan 3 Department of Electrical ... the minimization of root-mean-squared group-delay error. In the inner loop, an iterative quadratic optimization is proposed to replace the original nonlinear optimization for the minimization of...

Ngày tải lên: 21/06/2014, 07:20

Ngày tải lên: 21/06/2014, 20:20

Ngày tải lên: 27/06/2014, 07:20

Ngày tải lên: 07/08/2014, 23:22