a new form of intelligence on earth
A new form of the c metric
... pair of dilaton black holes uniformly accelerating apart Using the dilatonic generalization of the Ehlers-Harrison type transformation [85], they also found the dilatonic generalization of the Ernst ... creation rate of non-extremal black holes Later on, the problem of the pair creation of dilaton black holes in a background magnetic field was also studied [49, 48] The study of the pair creation ... sources of the matter λ satisfies (2.6 0a) , which is the Laplace equation in the flat background Euclidean space of ρ and z It is natural to interpret λ as the Newtonian gravitational potential Recall...
Ngày tải lên: 16/09/2015, 15:43
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase amy_Aspaw a- amylase CBM20 (Purple of Fig.2) atrActsp ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA00331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA33386 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA ... (110) GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) AGGCGgtgag/tccagTTGAA GACCGgtaag/tccagCTGCT GTGCGgtgag/tgtagGAGAC (110) AGGCGgtgag/tttagTTGAG GACCGgtaag/tccagCTGCT CTGCGgtgag/tgcagGAAAA (110)...
Ngày tải lên: 17/03/2014, 03:20
báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx
... information contained in each of the selected units was compared and a common conceptual denomination was assigned to the group of segments sharing the same clinical profile as a standard As a ... of the organizational model of signification is noted and its form of production by means of a typology of elemental relations" These relations are: contradiction, contrariness and the ability ... representation of the conceptual characterization of the model Graphic Graphic representation of the conceptual characterization of the model Page 12 of 17 (page number not for citation purposes)...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo toán học: "On a new family of generalized Stirling and Bell numbers" pps
... rediscovered by Katriel [17] in connection with normal ordering expressions in the boson annihilation a and creation operator a satisfying the commutation relation aa† − a a = of the Weyl algebra Since ... very natural insofar as many properties of the conventional Stirling number of second kind find a simple analogue For example, the interpretation of S(n, k) as a rook number of a staircase Ferrers ... generalization of the commutation relation (1), namely, UV − V U = hV s , (5) where it was assumed that h ∈ C \ {0} and s ∈ N0 The parameter h should be considered as a free “deformation parameter”...
Ngày tải lên: 08/08/2014, 14:23
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot
... Arthritis and Musculoskeletal Alliance Standards of care for people with inflammatory arthritis [74] Podiatry Rheumatic Care Association Standards National Institute for Health and of care for ... Klarlund M, Court-Payen M, Thomsen HS, ỉstergaard M: Ultrasonography of the metatarsophalangeal joints in rheumatoid arthritis: comparison with magnetic resonance imaging, conventional radiography, ... Lehtinen A, Paimela L, Kreula J, Leirisalo-Repo M, Taavitsainen M: Painful ankle region in rheumatoid arthritis Analysis of soft-tissue changes with ultrasonography and MR imaging Acta Radiol 1996,...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... the acquisition of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read...
Ngày tải lên: 25/10/2012, 10:35
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... gồm tỉnh Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - ... “Cần Thơ gạo trắng nước trong”, “Gạo Cần Đước, nước Đồng Nai”, “Cơm Nai, R a; cá Rí, Rang” hay: “Ai miệt Tháp Mười, Cá tôm sẵn bắt, l a trời sẵn ăn ” (ca dao) v.v Trong Gia Đònh thành thông chí ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh...
Ngày tải lên: 17/04/2013, 16:09
Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc
... design of current motorcycles You need to collect information to make an informed decision about the type of motorcycle that will attract new riders After you collect and analyze the information, ... designers at a motorcycle factory Next, identify a spokesperson who can present the group’s ideas in a class discussion Brainstorm about your answers and present them in any format that will communicate ... Indicate at least two questions that you can ask each source Different sources may require different types of questions Assume that the three sources you identified have provided all of the information...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
... group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of tools and ... Dilemmas: The Anatomy of Cooperation, explains that, Social dilemmas are situations in which individual rationality leads to collective irrationality That is, individual rational behavior leads ... at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many Peter Kollock, author of Social...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt
... Integrins and actin filaments: reciprocal regulation of cell adhesion and signaling J Biol Chem 275, 22607–22610 Papakonstanti EA, Vardaki EA & Stournaras C (2000) Actin cytoskeleton: a signaling ... carried out with ouabain, a natural blocker of the Na+ pump and an inhibitor of palytoxin action, have provided interesting findings Through the partial inhibition of Na+ ⁄ K+-ATPase, and regardless ... cells: (a) the distortion of the actin cytoskeleton begins at early stages, being detectable after 10 of toxin incubation; and (b) both microfilament reorganization and morphological alterations are...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf
... carbon, water and waste emissions management, as well as on intangible assets such as the value of trust, reputation and effective stakeholder management Beyond the confines of financial performance, ... challenges of integration, and shape the conditions that will be conducive to more sustainable companies operating in a more sustainable economy 24 Supply chain management and sustainable packaging ... skills, and measuring a new concept of value within organizations are critical conditions for change Yet we also see a strong determination on the part of CEOs to take the necessary actions to meet...
Ngày tải lên: 18/02/2014, 21:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... the catalytic domain of DESC1 Experimental procedures Cloning, expression and purification Cloning, expression and purification of the DESC1 catalytic domain was performed at Corvas International ... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... performed on a human prostate Marathon-Ready cDNA (Clontech, Mountain View, CA, USA) Two fragments were isolated and confirmed by Southern analysis using the internal cDNA fragment as the probe and...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu STRENGTHEN CONFIDENCE AND WORK TOGETHER FOR A NEW ROUND OF WORLD ECONOMIC GROWTH doc
Ngày tải lên: 21/02/2014, 01:20
Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx
... Tm-mas A secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a dilution of : 1000 Phage DNA was isolated from phage lysates by using a lambda DNA preparation ... pro-PO activation reaction MATERIALS AND METHODS Animals, collection of hemolymph and hemocytes T molitor larvae (mealworm) were maintained on a laboratory bench in terraria containing wheat bran ... molecular level This paper describes the purification and cDNA cloning of a 45-kDa protein that acts as a pro-PO activating cofactor in T molitor larvae The deduced amino acid sequence of the 45-kDa...
Ngày tải lên: 21/02/2014, 03:20
Life and Physical Sciences Research for a New Era of Space Exploration docx
... TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant viii AERONAUTICS AND SPACE ... http://www.hhs.gov/ohrp/policy/common.html National Aeronautics and Space Act of 1958 Institute of Medicine, Safe Passage: Astronaut Care for Exploration Missions, National Academy Press, Washington, D.C., 2001 National Research ... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant...
Ngày tải lên: 05/03/2014, 11:21
Research Program of the Partnership for a New Generation of Vehicles doc
... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... Program Officer MARTIN OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory,...
Ngày tải lên: 06/03/2014, 15:20
A New Database of Financial Reforms pot
... Greece Nepal Thailand Bulgaria Guatemala Netherlands Tunisia Burkina-Faso Hong Kong New Zealand Turkey Cameroon Hungary Nicaragua Uganda Canada India Nigeria Ukraine Chile Indonesia Norway United ... Lithuania Spain Azerbaijan Finland Madagascar Sri Lanka Bangladesh France Malaysia Sweden Belarus Georgia Mexico Switzerland Belgium Germany Morocco Taiwan Bolivia Ghana Mozambique Tanzania Brazil ... Lexington Books) (Contains financial reform information for the U.S., Japan, Australia, New Zealand, Korea, Taiwan, the Philippines, Thailand, Indonesia, China, Singapore, Malaysia and Canada) De...
Ngày tải lên: 06/03/2014, 19:20