a new array called blockarray is instantiated

macromedia flash mx advanced for windows and macintosh

macromedia flash mx advanced for windows and macintosh

... trademark of Peachpit Press, a division of Pearson Education Macromedia is a registered trademark, and Macromedia Flash and Flash are trademarks of Macromedia, Inc Throughout this book trademarked ... guided layer (Layer above) and inserting a new layer automatically modifies the new layer as a guided layer (Layer 3) or Drag an existing normal layer below the guide layer The normal layer becomes ... “Hogg” Viator, Khin Mai Aung, David Harrington, SadSadFun (A Gass, B Chulada, F Parsa, and M Chulada), Derek Jimenez, and Tim Cramer Additional images and sound provided courtesy of Benjamin Cummings,...

Ngày tải lên: 03/06/2014, 02:04

819 4,2K 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... human manganese superoxide dismutase: effects on structure, stability, and catalysis Biochemistry 39, 7131– 7137 31 Hiraoka, B.Y., Yamakura, F., Sugio, S & Nakayama, K (2000) A change of the metal-specific ... Institut Jacques Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
Báo cáo Y học: The N-terminus of m5C-DNA methyltransferase Msp I is involved in its topoisomerase activity docx

Báo cáo Y học: The N-terminus of m5C-DNA methyltransferase Msp I is involved in its topoisomerase activity docx

... (W3 4A) and 5¢-AT ATTCTAGAAAGCTAACCAGAATCAA-3¢ (Y7 4A) The mutants were identified by DNA sequencing of the plasmid DNA Expression and purification of truncated Msp I (del 34aa) Using the intact M.MspI ... pMSP plasmid as template, a PCR amplification of truncated MspI (deletion of 34 N-terminal amino acids; del34aa) was made using the following set of primers: 5¢-CATATGgaatcaggtaaaaca-3¢ and 5¢-tgttttacctgattccCATATG-3¢ ... both are human parasites Nocardia aerocolonigenes (the host of NaeI) and Moraxella (host of M.MspI) are also capable of being human parasites Two prototype bacterial m5C-MTases, M.HhaI [32] and...

Ngày tải lên: 24/03/2014, 00:21

7 515 0
Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc

Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc

... stoichiometric amounts were calculated based on the amino acid analysis performed during the synthesis of b1)34 and calibrated with the FO sample assuming a stoichiometry of ab2c10 Dialysis was carried ... experiments revealed that an approximately 6-fold molar excess of b1)34 was necessary to obtain saturated H+ translocation activities, whereas the use of higher molar ratios had no further stimulating ... between F1 and FO [6] This physical linkage between the site of catalysis and ion translocation is further associated with functional needs of coupling by means of elasticity The axial deformation...

Ngày tải lên: 23/03/2014, 13:20

7 233 0
Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf

Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf

... generally tame Hopf algebras, we need more examples of tame Hopf algebras The Andruskiewitsch-Schneider algebra is a kind of generalization of generalized Taft algebra and of course Taft algebra Therefore, ... Therefore, it is natural to ask the following question: whether is the quantum double of dual AndruskiewitschSchneider algebra a tame algebra? In this paper, we give an a rmative answer As a consequence, ... we know that the most typical examples of basic Hopf algebras of finite representation type are Taft algebras and the dual of A( n, d, μ, q), which as an associative algebra is generated by two...

Ngày tải lên: 06/08/2014, 05:20

19 386 0
Báo cáo sinh học: "The genetic control of ovariole in Sitophilus oryzae L is temperature sensitive" pptx

Báo cáo sinh học: "The genetic control of ovariole in Sitophilus oryzae L is temperature sensitive" pptx

... 1970; Ganesalingam, 1974) At the anterior tip of each ovariole, a bacteriome containing intracellular bacteria is formed (Mansour, 1930; Nardon, 1971) This apical bacteriome disappears in the absence ... Temperature-sensitive gaster IV A mutation affecting Nat Acad Sci USA 67, 738-745 eye facet mutations in arrangement in a Drosophila melanopolarized manner Proc Ganesalingam VK (1974) Morphological ... eye facet arrangement (heterozygous females are of wild type at 29°C and mutant type at 21°C, Foster and Suzuki, 1970); and in a homeotic mutation affecting imaginal discs, giving normal arista...

Ngày tải lên: 09/08/2014, 18:21

18 273 0
Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx

Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx

... patients were bilaterally affected Fifty four patients had CTS hands on the unilateral side and 54 contra-lateral hands were asymptomatic The diagnosis of CTS in all patients was reconfirmed at ... originates from three separate cervical roots (C6, C7, C8) and its motor fiber of that from C8 and Th1 roots 3) Damage due to the axonoplasmic flow disturbance that Uptom and McComas advocated is axonal ... increases its susceptibility at a distal site and the degree of damage at the distal compression site on the same nerve fiber They attributed this condition to a disturbance in axonoplasmic flow at...

Ngày tải lên: 10/08/2014, 10:20

7 298 0
Báo cáo y học: "Effects on respiratory function of the head-down position and the complete covering of the face by drapes during insertion of the monitoring catheters in the cardiosurgical patien" pot

Báo cáo y học: "Effects on respiratory function of the head-down position and the complete covering of the face by drapes during insertion of the monitoring catheters in the cardiosurgical patien" pot

... times and A similar comparison between times and showed a small nonsignificant increase in PaO2 and SaO2 in groups A1 and B1, and a significant increase (P < 0.05) in PaO2 and SaO2 in group C After ... considered statistically significant In all patients, LVEF was assessed by cardiac angiography Results The arterial blood samples to determine oxygen (PaO2) and carbon dioxide (PaCO2) tension and oxygen ... nonsignificant change in PaO2 and SaO2 at times 3, and at all times In patients in groups A2 and B2, SaO2 was never below 93% during the two manoeuvres [5] PaCO2 remained stable, without significant change...

Ngày tải lên: 12/08/2014, 18:20

5 374 0
Báo cáo y học: "The acute effects of body position strategies and respiratory therapy in paralyzed patients with acute lung injury" doc

Báo cáo y học: "The acute effects of body position strategies and respiratory therapy in paralyzed patients with acute lung injury" doc

... data were collected and analyzed with commercially available data management and statistical software All data are shown as means ± SD Data were analyzed with analysis of variance for repeated ... secretion clearance in paralyzed patients This finding might be specific to paralyzed patients who are unable to cough Changes in body position are an important part of postural drainage and this is most ... that automatically turn patients on a much more frequent basis independently of caregiver availability Several clinical trials have suggested that this type of rotational or ‘kinetic’ therapy...

Ngày tải lên: 12/08/2014, 18:20

7 320 0
Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

... stress in each of the following questions Question 46: He objected to ………… A his mistakes being laughed at B laughing his mistakes at C his mistakes laughing at D his mistakes at laughing Question ... functions on a 24hour basis and is called the circadian clock (from the Latin, circa “about” + dies “day”).This body clock programmes us to be sleepy twice a day, between 3-5 a. m and again between ... is allowed to enter the area without permission A You can enter the area if you ask for permission B You can’t enter the area under any circumstances C You can’t enter the area without allowance...

Ngày tải lên: 08/10/2014, 16:46

13 3,6K 0
Mark the letter a  b  c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

... three movies already A has appeared B has been appearing C had appeared D appeared Question 27 : This jacket doesn’t me; it’s too tight across the shoulders A match B reach C equal D fit Question ... Environmental organisations have been to inform people and gain their support A set up B put up C made up D carried out Question 14 : Martha Thomas was an American educator who stood for equal ... announcement was made A No sooner did everyone start complaining than the announcement was made B Everyone started complaining that the announcement was made C No sooner had the announcement made than everyone...

Ngày tải lên: 08/10/2014, 16:46

15 4,2K 0
Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"

Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"

... disclosure and analysis Page of (page number not for citation purposes) Many academic centers are increasingly recognizing engagement in quality improvement as a distinct career pathway [15] Involving ... 1:296-305 Braithwaite RS, DeVita MA, Mahidhara R, Simmons RL, Stuart S, Foraida M: Use of medical emergency team (MET) responses to detect medical errors Qual Saf Health Care 2004, 13:255259 Kaplan LJ, ... Localio AR, Weaver SL, Landis JR, Lawthers AG, Brenhan TA, Hebert L, Sharp TJ: Identifying adverse events caused by medical care: degree of physician agreement in a retrospective chart review Ann...

Ngày tải lên: 25/10/2012, 10:06

2 428 0
Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"

Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"

... prefabricated expanded flaps carried by temporoparietal fascia flaps Plast Reconstr Surg 2009; 123(2): 556-61 Navarro-Ceballos R, Bastarrachea RA Clinical applications of temporoparietal hair-bearing ... skin island, deep temporal fascia, and also segmental parietal bone can be raised with this flap The TPFF and its variants can be used as free or pedicled, one or two-stage (prefabricated and ... primary conchal cartilage grafts, a free temporoparietal fascial flap, and a full-thickness supraclavicular skin graft.19 The temporoparietal fascial flap has been commonly used for coverage...

Ngày tải lên: 25/10/2012, 11:00

7 728 0
Báo cáo y học: "Anticancer Activity of the PR Domain of Tumor Suppressor RIZ1"

Báo cáo y học: "Anticancer Activity of the PR Domain of Tumor Suppressor RIZ1"

... and then examined under a microscope At least 100 cells were counted for each treatment Statistical analysis was performed using GraphPad InStat (GraphPad Software, San Diego, California, USA) ... level at each individual cancer stage (Fig 1), however, the small sample size associated with the panel (n=12 for each cancer type) precluded a complete analysis, one that must await a larger scale ... respectively, and 4.8 folds at stage III in prostate cancer (Fig 1) Because cancer undergoes metastasis and spreads to other organs at late stages, we speculated that RIZ1 might play an important role...

Ngày tải lên: 25/10/2012, 11:15

7 467 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

... using Kodak Digital Science 1D 2.0 imaging software Statistical Analysis Data are presented as mean ± SD Data of multiple groups were analyzed by one-way analysis of variance Means between two ... dehydrogenase (GAPDH): forward: 5’-GCGCCTGGTC ACCAGGGCTGCTT-3’, reverse: 5’-TGCCGAAGTG GTCGTGGATGACCT-3’; b) Cx40-1: forward: 5’-ATGCACACTGTGCGCATGCAGGA-3’, reverse: 5’-CAGGTGGTAGAGTTCAGCCAG-3’; ... clerosis and AngII, whether up-regulation of Cx43 can be antagonized by AT1 antagonists or whether suppressed smooth muscle cell proliferation and migration by AT1 antagonists are mediated through...

Ngày tải lên: 26/10/2012, 09:39

8 467 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

... such as immunosuppression, insulin resistance, non-alcoholic steatohepatitis, hemochromatosis, and schistosomiasis Table Fibrosis Risk Factors for Advanced Progression of Liver Risk Factors Alcohol ... hepatocellular carcinoma in patients with hepatitis C virus-related cirrhosis: a metaanalysis Aliment Pharmacol Ther, 2001 15(5): 689-98 60 Tong M.J, et al Clinical outcomes after transfusion-associated ... cirrhosis In mild cases, fibrosis is limited to the portal and periportal areas More advanced changes are defined by fibrosis that extends from one portal area to another, also known as "bridging...

Ngày tải lên: 02/11/2012, 09:56

6 530 0
Báo cáo y học: "Foundation for the Community Control of Hereditary Diseases, Budapest, Hungary"

Báo cáo y học: "Foundation for the Community Control of Hereditary Diseases, Budapest, Hungary"

... abnormality (CA) (e.g neural-tube defect) Fetal disease (e.g fetal toxoplasmosis) Genetic disease (e.g cystic fibrosis) Intrauterine growth retardation (idiopathic) Disability (e.g mental subnormality) ... with particular emphasis of primary prevention Tsitologija i Genetika 2002; 36: 56-71 Figure Figure Classification of Congenital Anomalies Congenital Anomalies (Birth Defects) Congenital abnormality ... selective abortion, i.e termination of pregnancy after the prenatal diagnosis of severe fetal defects was also named as secondary prevention Recently the WHO and other international bodies have excluded...

Ngày tải lên: 02/11/2012, 11:12

2 626 0
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"

Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"

... disease-causing sequences via embryo pre-screening Given the low transfer efficiencies and safety risks available at present (i.e extrapolating from animal transgenesis), candidate disorders would have ... three animals were born, one of which was transgenic Additionally, a miscarried pair of twins was transgenic Although this ‘combined’ method of gene transfer is laborious, it is the only approach ... does appear to be somewhat better than that of pronuclear microinjection The available experimental data on standard human ICSI (i.e not involving genetic modification) indicate that: (a) the majority...

Ngày tải lên: 03/11/2012, 10:01

16 507 1
Báo cáo y học: "The primary prevention of birth defects: Multivitamins or folic acid"

Báo cáo y học: "The primary prevention of birth defects: Multivitamins or folic acid"

... regional antenatal care clinics b) The HCCSCA HCCSCA is based on the Hungarian Congenital Abnormality Registry (HCAR) [18] which is a national-based registry of cases with CAs Notification of CAs is ... (0.01-0.47) * Anencephaly 2, Anencephaly +spina bifida (lumbal, thoracolumbal) 2, Spina bifida 2, thoracolumbal 1, lumbosacral ** Anencephaly ***Anencephaly 1, Spina bifida 8, thoracolumbal 1, lumbal 4, ... The fifth step was the statistical analysis of data using the SAS version 8.02 statistical software package (SAS Institute Ins., Cary, NC, USA) Potential confounders were evaluated using Student’s...

Ngày tải lên: 03/11/2012, 10:05

12 487 0
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

... Hepatitis B Foundation of America; an Appropriation from the Commonwealth of Pennsylvania USA, Nucleonic Inc (PA USA) Drs Satishchandran C and Cathy Pachuk (Nucleonics Inc, PA, USA), Baohua Gao ... Machida A, Kishimoto S, Ohnuma H, Miyamoto H, Baba K, Oda K, Nakamura T, Miyakawa Y, Mayumi M A hepatitis B surface antigen polypeptide (P31) with the receptor for polymerized human as well as ... The Hepatitis B virus (HBV), which belongs to the hepadnavirus family, is a small circular DNA virus containing a nucleocapsid and an envelope HBV nucleocapsid contains a relatively small and incompletely...

Ngày tải lên: 03/11/2012, 10:09

13 654 1
w