a new approach to disease diagnosis and management

... vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches to pursue muscular dystrophy diagnosis [223] Similarly, ... 51(12):2333-2340 Okamoto M, Kawabe T, Iwasaki Y, Hara T, Hashimoto N, Imaizumi K, Hasegawa Y, Shimokata K: Evaluation of interferon-gamma, interferon-gamma-inducing cytokines, and interferongamma-inducible ... Kinoshita T, Okamoto M, Kawayama T, Kato S, Iwasaki H, Watanabe K, Aizawa H: Interleukin-18 production and pulmonary function in COPD Eur Respir J 2008, 31(2):287-297 Saetta M, Mariani M, Panina-Bordignon...

Ngày tải lên: 12/08/2014, 14:20

... of haptoglobin receptors in human hepatoma cells Biochim Biophys Acta 1136, 143–149 20 Oshiro S, Yajima Y, Kawamura K, Kubota M, Yokofujita J, Nishibe Y, Takahama M & Nakajima H (1992) Catabolism ... HPT1 and HPT2 variants were built using the program NEST [40], a fast modelbuilding program that applies an ‘artificial evolution’ algorithm to construct a model from a given template and alignment ... region and of the adjacent hydrophobic surface area available for binding misfolded proteins In addition, pKa calculations indicate that Asp193, as a result of its poorly solventaccessible location...

Ngày tải lên: 23/03/2014, 06:20

... accept that the new keyword creates a new instance of a class (more commonly called an object) IMPORTANT Don't get confused between the terms class and object A class is the definition of a ... just as you can create many int variables in a program Each instance of the Circle class is an object that occupies its own space in memory, and runs independently of all the other instances ... type An object is an instance of that type, created when the program runs For example, it is possible to create many instances of the Circle class in a program by using the new keyword, just as...

Ngày tải lên: 15/12/2013, 00:15

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...

Ngày tải lên: 19/02/2014, 05:20

... 95–104 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M, Stillman B & Araki T (2001) FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristems ... topoisomerase II interacts with Lim15/Dmc1 in meiosis Nucleic Acids Res 33, 5809–5818 Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG...

Ngày tải lên: 07/03/2014, 05:20

... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... putative HIPPI-binding motif and its mutants ND, not determined Fluorescence quenching Sequence EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG ... positive strand, and the sequences AA AGAAAAG () 651 to ) 643), AAAGAAAAG () 725 to ) 717) and GAAGACATT () 849 to ) 857) are present in the negative strand Given that the caspase-8 and caspase-10...

Ngày tải lên: 07/03/2014, 10:20

Ngày tải lên: 13/05/2014, 09:28

... strain standard strain *All the strains used in the study were isolated and characterized at Mycobacteria Laboratory, IVRI, Izatnagar (India) and were derived from animals/human from IVRI campus ... human to human [1], human to animal [9], animal to human [4] and animal to animal [12] In a tuberculosis outbreak of human or animal, it is often important to establish the source of infection and ... the disease is due to a new strain or relapse of a single strain that is disseminating in a particular population Identification and differentiation of strains of M 334 Sandeep Kumar Singh et al...

Ngày tải lên: 07/08/2014, 18:20

... forward 5'-GTGAACGCCGTGCACTGGTTCCGAAAGGGAC-3', mCry1 reverse 5'GTCATGATGGCGTCAATCCACGGGAAGCCTG-3'; mPer2 forward 5'-GATCAGCTGCCTGGACAGTGTCATCAGGTACC-3', and mPer2 reverse 5'-CTGAGCGTCGAGGTCCGACTAGGGAACTCAGCC-3' ... Hitomi K, Thresher RJ, Ishikawa T, Miyazaki J, Takahashi JS, Sancar A: Differential regulation of mammalian period genes and circadian rhythmicity by cryptochromes and Proc Natl Acad Sci USA ... Sato TK, Panda S, Miraglia LJ, Reyes TM, Rudic RD, McNamara P, Naik KA, FitzGerald GA, Kay SA, Hogenesch JB: A functional genomics strategy reveals Rora as a component of the mammalian circadian...

Ngày tải lên: 10/08/2014, 09:20

... larvae migrate through the liver and lung and result in a plethora of allergic and inflammatory manifestations, referred to as visceral, ocular or cutaneous larva migrans Eosinophilia, elevated ... expression of class II MHC and interferon-gamma Cell 1988, 52:773-782 30 Kitaura J, Song J, Tsai M, Asai K, Maeda-Yamamoto M, Mocsai A, Kawakami Y, Liu FT, Lowell CA, Barisas BG, Galli SJ, Kawakami T: ... serology, stool exam Protozoan Malaria Clinical, blood smear Malignancy Hematological Myeloma, Lymphoma SPEP***, Bone marrow Inflammatory Solid tumor Vasculitides Lung/colon/Breast Kawasaki, PAN*,...

Ngày tải lên: 13/08/2014, 13:22

... database Khi ta phải rõ vị trí primary data file transaction log file Ví dụ: USE master GO CREATE DATABASE Products ON ( NAME = prods_dat, FILENAME = server\mssql\data\prods.mdf', SIZE = 4, MAXSIZE ... KB KB Tạo Một User Database Chúng ta tạo database dễ dàng dùng SQL Server Enterprise cách right-click lên "database" chọn "New Database" hình vẽ sau: Sau việc đánh tên database click OK Ngoài ... memory (vùng nhớ gọi data cache), sau data data cache thay đổi(những trang bị thay đổi gọi dirtypage) Tiếp theo thay đổi ghi vào transaction log file người ta gọi write-ahead log Cuối trình gọi...

Ngày tải lên: 25/08/2012, 09:00

... spinal-epidural analgesia and anaesthesia 63 26 Spinal analgesia 67 27 Caudal analgesia 69 28 Spinal and epidural opioids 69 29 Inhalational analgesic drugs 72 30 Systemic analgesic drugs 74 31 Non-pharmacological ... to oxytocics For a termination of pregnancy at less than 15 weeks, standard concentrations of volatile anaesthetic agents not appear to pose a risk and may be used to maintain anaesthesia Analgesia ... Ergometrine causes increased intracranial and systemic pressure, and nausea and vomiting, and should not be used routinely • Spinal anaesthesia produces more rapid and dense anaesthesia than epidural and...

Ngày tải lên: 21/09/2012, 10:39

... Info AAA AAB AAAb AAB Dundee East Anglia Edinburgh Glasgow Guy’s, King’s AABc and St Thomas’, 370 tariff points Cardiff Acceptable on its own and combined with other qualifications Chemistry and any ... England, Wales and Northern Ireland BMAT compulsory Graduate entry and Pre-Medical course available UKCAT compulsory Graduate entry available Graduate entry available UKCAT compulsory UKCAT compulsory ... great player) is good for her and for her hospital Then there is the invaluable down -to- earth ability to organise and to cope; a capable pair of hands and a reassuring attitude of “leave it to...

Ngày tải lên: 21/09/2012, 10:58

... performed five days later and were read by a radiologist The radiographs revealed well-marginated juxta-articular bony erosions at the radial styloid process and the dorsal rim of the distal radius with ... arthritis although advanced imaging techniques may be used The appearance of gout in MR imaging is variable Joint effusion and para-articular edema may be present in an inflamed joint Tophaceous ... joint Natural history of an acute attack ranges from a few days to a few Page of (page number not for citation purposes) Chiropractic & Osteopathy 2007, 15:16 weeks Radiographs during early attacks...

Ngày tải lên: 25/10/2012, 10:06

... statement I am awake You are awake She is awake We are awake Affirmative statement with tag question I am awake, am I not? You are awake, aren't you? She is awake, isn't she? We are awake, aren't we? ... regarded as “partial negative” Apart from adverbials, the ambiguity is also made by an operator in a negative, here, operator is not a normal auxiliary expressing grammatical function, but a modal ... English and Vietnamese negative questions have been analysed and pointed out With an ambition to help teachers and learners have a clear understanding about the English and Vietnamese negative...

Ngày tải lên: 07/11/2012, 14:36

... potential means total potential and β is the van der Waals interaction parameter For a thermodynamics point of view, β can be well correlated with van der Waals parameters a and b in the van der Waals ... self-assembly processes are random, while others are directional to some degree Molecular, colloidal, interfacial selfassemblies are random cases, and some atomic and biological self-assemblies are ... SELF-ASSEMBLY AND NANOTECHNOLOGY SELF-ASSEMBLY AND NANOTECHNOLOGY A Force Balance Approach Yoon S Lee Scientific Information Analyst Chemical Abstracts Service A Division of the American Chemical...

Ngày tải lên: 15/11/2012, 10:12

Ngày tải lên: 07/02/2013, 09:32

... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored ... by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was anchored from ¼ weak ... currant flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight off-flavor described as ‘artificial’...

Ngày tải lên: 03/04/2013, 21:06

... Vietnamese organizations to change to adapt to new situation Therefore, it is necessary for Vietnamese organizations to abandon backward management and apply new management styles For this reason, ... behaviors and change the organization culture The first thing we have to is to explain why we have to reduce bureaucracy and to be more proactive and what the organization will be like, and raise ... effective and proactive To change from a SOE to a JSC (Joint Stock Company) is an positive step to reduce bureaucracy and make employees especially managers to be more proactive After creating a common...

Ngày tải lên: 05/04/2013, 14:58