a multilevel and structural equation model approach

... chiến lược (Menon, Bharadwaj, Howell, 1996; Menon,Bharadwaj, Adidam, Edison, 1999) tài liệu quan hệ marketing (Cannon & Homburg năm 2001; Ganesan Shanker, 1994) đề xuất quy mô a chiều để đánh giá ... quan đến giao dịch -Giá trị mua Đánh giá tổng thể người mua công nghiệp giá trị thực giao dịch cụ thể d a đánh giá người mua lợi ích họ nhận được cung cấp giao dịch đ a (chi phí mua sử dụng giao ... quan hệ việc trao đổi niềm tin vỡi đối tác mối quan hệ diễn với người khác đủ quan trọng để đảm bảo nỗ lực tối a để trì Định ngh a tương ứng gần xác với phát triển Moorman, Zaltman, Deshpande...

Ngày tải lên: 12/08/2014, 23:11

... Tyr158, Glu212, Arg215 and Trp246 in ricin) and another ve conserved residues (Asn72, Arg124, Gln160, Glu195 and Asn196 in abrin -a and abrin-c and Asn78, Arg134, Gln172, Glu208 and Asn209 in ricin) ... USA) Restriction endonucleases, and DNA ladders were obtained from Promega Factor Xa protease was purchased from Biolabs (Beverly, MA, USA) All other chemicals used were analytical grade Plant ... based on DNA sequences obtained previously Thus, the sequences of the primers used for 5Â RACE were: 5Â-GGGCATCACGGA AGAAATAG-3Â for a reverse transcription and 5Â-GC TCTAGAGCATTCGTCACATCGATACC-3Â...

Ngày tải lên: 07/03/2014, 16:20

... metabolism, and chorismate synthase and acetolactate synthase, which are necessary for amino acid biosynthesis Examples of species with a minimal set of enzymes are Pyrococcus abyssi, T maritima, and Saccharomyces ... clan FAD_Lum_binding) In addition, a novel covalent attachment between a side chain carboxylate group of an aspartate and the 8a- position of the isoalloxazine system was discovered in an FADdependent ... The majority of covalently bound flavins are present as FAD rather than FMN (Table S2) Interestingly, covalent attachment of FAD occurs only in the two most abundant clans, NADP_Rossmann and FAD_PCMH,...

Ngày tải lên: 28/03/2014, 22:20

... metabolism, and chorismate synthase and acetolactate synthase, which are necessary for amino acid biosynthesis Examples of species with a minimal set of enzymes are Pyrococcus abyssi, T maritima, and Saccharomyces ... clan FAD_Lum_binding) In addition, a novel covalent attachment between a side chain carboxylate group of an aspartate and the 8a- position of the isoalloxazine system was discovered in an FADdependent ... The majority of covalently bound flavins are present as FAD rather than FMN (Table S2) Interestingly, covalent attachment of FAD occurs only in the two most abundant clans, NADP_Rossmann and FAD_PCMH,...

Ngày tải lên: 28/03/2014, 22:21

... philanthropic and social-liberal ideas envisaged savings banks as a means to fight and prevent poverty In Hamburg a savings bank was founded in 1778, “for people of lesser means”, and a few years ... great importance Because of the saving bank’s philanthropic and patriarchal nature, and because its loans were small, borrowers and guarantors were trusted more than real securities In small ... 36 In many cases, loans were granted to the members of savings bank boards of directors, but also against personal guarantee and against collateral In ports, loans were usually granted against...

Ngày tải lên: 29/03/2014, 08:20

... contrast of mask Cat Model (texture params) Model (structure params) Model (edge params) (d) Hand Model (texture params) Model (structure params) Model (edge params) (b) RMS contrast of target (a) ... wood, newspaper, and basket; structures: baby, pumpkin, hand, cat, and flower; edges: butterfly, sail, post, handle, and leaf C = 0.04 C = 0.02 C = 0.01 Newspaper n /a n /a n /a Basket n /a n /a n /a Textures ... as a free parameter that is adjusted to match TvC curves We too have left g as a free parameter 3.1.2 The Excitatory and Inhibitory Exponents p and q, and the Semisaturation Constant b The parameters...

Ngày tải lên: 22/06/2014, 00:20

... research aims The XGAP data format can be used to represent and exchange all raw, intermediate and result data associated with an investigation, and an XGAP database, for instance, can be used as a ... subjects and traits To understand basic data in XGAP, newcomers just have to learn that all data are stored as Data matrices with each DataElement describing an observation on Subjects and/ or Traits ... data are uploaded and to provide a consistent user experience Biologists can use the graphical user interface to navigate and retrieve available data for analysis They can use the advanced search...

Ngày tải lên: 09/08/2014, 20:21

... A, Yamazaki K, Hosono N, Myouzen K, Tsunoda T, Kamatani N, Furuichi T, Ikegawa S, Ohmura K, Mimori T, Matsuda F, Iwamoto T, Momohara S, Yamanaka H, Yamada R, Kubo M, Nakamura Y, Yamamoto K: A ... Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP-70 gene causes autoimmune ... (phalangeal, metacarpal/tarsal and carpal/tarsal), the stifle (or “knee”) joint and, occasionally, the vertebral joints The cellular infiltrate was largely described as neutrophilic and histocytic and...

Ngày tải lên: 12/08/2014, 17:22

... Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP-70 gene causes autoimmune ... severe organ disease or life-threatening disease All DMARDs can slow progression of joint damage as well as gradually decrease pain and swelling IL-1 inhibitor Adalimumab, etanercept, infliximab, certolizumab, ... certolizumab, golimumab Anakinra B-cell-depleting agent T-cell co-stimulation antagonist IL-6 antagonist Rituximab Abatacept Tocilizumab Suppresses inflammation and inhibit the progress of joint damage...

Ngày tải lên: 12/08/2014, 17:22

... = ln πab a1 b1 +a + a2 + b2 √ a b b1 arctan √ + b a1 arctan √ a1 b1 (1.4) a arctan a − b arctan b where a= asp , L a= a1 = + a2 , bsp , L b1 = + b2 where, asp and bsp are the length and width ... 1971], Hayakawa et al [Hayakawa and Hwang, 1981], Zanoni [Zanoni and Peri, 1993] and many others The models proposed are based on individual assumptions and though they succeeded in modelling ... of a set of algebraic inequalities which are explained in section 1.4 Therefore V and W in these two equations are ”adjusted” water and vapor rather than the actual water and vapor content at a...

Ngày tải lên: 16/09/2015, 12:42

... GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT 66.9 KHWTTSS2P4 AAGCTTATATCGCCGGGATAGCGTA 66.9 BTTTSS2P1 aaGAATTCGGTGGCCTCCAGAAACAGT 55.0 BTTTSS2P2 aaGGATCCGAGGACCCGCATGACAAG 55.0 ... GAATTCCGAACCGCTTTGTGATAACC KHWTTSS1P2 GGATCCGATCTTGAGCAGATGCTTG 60.7 KHWTTSS1P3 GGATCCGCCACGATATCCTCGAAAAG 60.7 KHWTTSS1P4 CTGCAGAGCTACGCCGTGAACGTATT 60.7 KHWTTSS2P1 GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA ... to plant pathogen Ralstonia solanacearum (Warawa and Woods, 2005) All the three related bacteria B pseudomallei, B thailandensis and B mallei share homology in both TTSS2 and TTSS3, yet a plant...

Ngày tải lên: 09/10/2015, 10:49

... second and third periods 2.8.2 Model specifications The data were analyzed using a standard multivariate linear sire model (LM), a recursive multivariate linear sire model (R-LM), a standard Gaussian-threshold ... between mastitis and MY during the first 180 days of first-lactation Norwegian Red cows For comparison, the data were also analyzed using standard multivariate linear and Gaussian-threshold models, as ... multivariate linear model; GT = standard Gaussian-threshold model; R-GT = recursive Gaussian-threshold model X.-L Wu et al R-LM CM1 LCM1 Bayesian structural equation Gaussian-threshold model a 347...

Ngày tải lên: 14/08/2014, 13:22

... useschronic and acute asthma ([neoplastic] Ê (lung Q cancer)) ([therapeutic] Ê (radiation Q therapy)) lung cancer lung cancer, radiation therapy ([disease]Êpancytopenia) ([neoplastic]Ê(acuteQmegakaryocyticQleukemia)) ... female with anorexia/bulimia complications and management of anorexia and bulimia ([disease] Ê diabete) ([disease] Ê (peripheral Q neuropathy)) ([therapeutic] Ê pentoxifylline) 50 year old diabetic ... original OHSUMED is not annotated with tags, we annotated it with tags representing document structures such as article and sentence , and annotated technical terms with tags such as disease and...

Ngày tải lên: 31/03/2014, 03:20

... signal extraction and learning (e.g Kydland and Prescott, 1982, and Cooley and Hansen, 1995); aggregation (e.g Christiano, Eichenbaum and Marshall, 1991 on temporal aggregation and Cooley et al ... Statistical Association (Chapters and 11) and Journal of Econometrics (Chapter 6) And the project has also been assisted greatly by the contributions of Yoga Affandi, Mutita Akusuwan, Mahid Barakchian, ... Global and National Macroeconometric Modelling This page intentionally left blank Global and National Macroeconometric Modelling: A Long-Run Structural Approach Anthony Garratt Department...

Ngày tải lên: 11/06/2014, 05:36

... Edir/SAsun + Idif , and that SAshade has a photosynthetic rate equal to that of a surface receiving Idif of stomatal inertia to a multiplicative Jarvis-type approach [15] Steady-state stomatal ... caused by radiation and soil moisture (e.g.: 1990 was a dry year, whereas 1988, 1992 and 1993 had the EMILION, a tree functional -structural model Table V Annual carbon balance (CBY) and cumulated ... by the sun SAshade is equal to the difference between total shoot area (SA) and SAsun We assumed that SAsun has the same photosynthetic rate as a needle area illuminated by a radiation intensity...

Ngày tải lên: 08/08/2014, 14:22

... minimal and maximal daily air temperatures, mean daily soil temperature at 20 cm depth, daily global radiation, daily hours of sunshine and daily air VPD Hourly values of air temperature and radiation ... each submodel of SIMWAL rather than to validate it in a strict sense RESULTS 2.2 Model inputs and data analysis Initial trees, input parameters and climate As far as possible, initial trees and input ... limiting at low irradiance and when Ci is high At a given leaf temperature, the key model parameters (maximum carboxylation rate, maximum electron transport rate, and respiration rate) are linearly...

Ngày tải lên: 08/08/2014, 14:22

... We regard 3D models as a reasonable amendment in craniofacial reconstruction that offers multiple advantages They facilitate surgical planning by demonstrating the anatomical characteristics of ... operated upon By adding a haptic sensation, this approach optimizes preoperative planning The surgeon achieves a better impression of the anatomical situation, the actual amount of bone and the ... University, Aachen, Germany Authors’ contributions BL was responsible for a part of the operation and drafted the manuscript LP was responsible for the planning and manufacturing of the templates and...

Ngày tải lên: 11/08/2014, 20:20

... immunoassays SJ and KW participated in the design of the study and performed the statistical analysis UJ, JK and CF conceived of the study, and participated in its design and coordination and helped ... The collagen matrix appears porose and knotty (Fig 6a and 6b) Page of Figure Collagen matrix, azan staining (100×): representative central area of pure collagen matrix With immuno-gold-labelling ... endochondral bone development and mediating bone vascularisation for normal differentiation of chondrocytes and osteoblasts An increase in VEGF is an indication of increased vascular permeability and...

Ngày tải lên: 11/08/2014, 20:20

... Education Standards for educational and psychological testing Washington, DC: American Educational Research Association; 1999 30 American Psychological Association., American Educational Research ... Research Association., National Council on Measurement in Education., American Psychological Association Standards for educational & psychological tests Standards for educational and psychological ... separated the patient and professional groups in order to facilitate frank discussion, and broad and rapid brainstorming To maximize the richness and depth of the data obtained, we used a nominal...

Ngày tải lên: 12/08/2014, 18:20

... administrative nightmares that I have caused and for your kind assistance throughout the last years Wendy, Sally, Latifah and Jenny, thank you for the administrative assistance that all you have rendered ... 40 Table Summary of hypotheses 75 Table Demographics characteristics of respondents 96 Table Mean, Standard Deviations, Average Cronbach’s Alpha and Correlations 100 Table MSEM baseline model ... Daily hassles Daily hassles are defined as experiences and conditions of daily living that have been appraised as salient and harmful to one’s well-being (Lazarus, 1984) In general, daily hassles...

Ngày tải lên: 09/09/2015, 11:09