a multi panel version of figure 4 13

modern neuroscience research protocol

modern neuroscience research protocol

... Dehydration and Embedding of Biological Specimens North-Holland, Amsterdam Golgi, C 1873 Sulla struttura della sostanza grigia dell cervello Gazetta medica italiana Lombarda 33, 244 – 246 (Translated ... TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG 3’ – primer 2B: 5’ TCCCCGTACATCGTTAGAAGCTTGAATTCGAGC [amino mod C7] 3’ – primer SAGE (biotinylated): 5’ [biotin] GGATTTGCTGGTGCAGTACA 3’ – primer SAGE (biotinylated): ... (biotinylated): 5’ [biotin] TTTTTTTTTTTTTTTTTT 3’ – primer 1A: 5’ TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATAGGGACATG 3’ – primer 1B: 5’ TCCCTATTAAGCCTAGTTGTACTGCACCAGCAAATC [amino mod C7] 3’ – primer 2A: ...

Ngày tải lên: 11/04/2014, 09:51

1,3K 1,1K 0
Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

... using animal samples from allantoic fluids Influenza virus strain (a) 1) A/ Chicken/Vietnam/8/ 04 2) A/ Chicken/Laos/26/06 3) A/ Chicken/Cambodia/ 1A/ 04 4) A/ Chicken/Malacca /49 05/03 5) A/ Gull/Denmark/68110/02 ... 6) A/ Shearwater/Aust/75 7) A/ Grey teal/WA/1762/79 8) A/ Emu/NSW/97 9) A/ Turkey/Ontario/6118/67 10) A/ Shearwater/Aust/72 11) A/ Mallard/Gurjev/263/82 12) A/ Mallard/Gurjev/ 244 /82 13) A/ Gull/Maryland/7 04/ 77 ... MRTG-3'- and NA10R-M13 5'-CAG GAA ACA GCT ATG AC CCI IKC CAR TTR TCY CTR CA-3' or NA8F 5'-GRA CHC ARG ART CIK MRTG-3' and NA10R 5'-CCI IKC CAR TTR TCY CTR CA-3' and to μL of RNA were added Thermocycling...

Ngày tải lên: 20/06/2014, 01:20

11 378 0
Primer design for the PCR amplification of the coad gene

Primer design for the PCR amplification of the coad gene

... begins with a C and PCR amplification will change this codon from CAA to GAA (and the second residue in the recombinant protein will be glutamate instead of glutamine) An alternative strategy which ... PPAT) CG GGATCCCTA CGCTAACTTCGCCATCAGC 5' extension (CG) BamH I restriction site (GGATCC) Complement of stop codon (CTA) Overlap with the strand complement to the 3'-end of the coaD gene Estimated ... in the amplification of the original gene is described in Utilisation of the Nco I site 3'-end primer No C-terminal tag is being used, so we have to add a stop codon (TAG is the natural stop...

Ngày tải lên: 14/07/2015, 23:53

2 481 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal ... pair 1G1P1 1G1P1 2G2P5 1G3P6 1G4P217 1G5P30 Primer sequence 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx

Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx

... Tag-specific primer NBAAAAAAA-3′ NVTTTTTTT 16 Modified oligo (dT) GGATCC 16 The 1st PCR GGATCC GGG CCC NBAAAAAAA NVTTTTTTT 16 cDNAs synthesis NBAAAAAAA NVTTTTTTT UP-I NBAAAAAAA NVTTTTTTT 16 The ... PLR UP-II GGATCC GGG CCC NBAAAAAAA NVTTTTTTT cDNA library NBAAAAAAA NVTTTTTTT 16 16 UP-II Fig Detailed mechanism of the amplification of the whole cDNAs and the TSAT-PCR technique (A) In this process, ... rest of the sequences did not match any clusters Tag sequence UniGene ID Abundance A B C D E 10 ACTTACCTGC GCGTGCCTGC GCCCCTGCGC GTGACCACGG GTGGCACACG AACGAGGAAT GTAAGTGTAC AGAGGTGTAG TTGCCAACAC...

Ngày tải lên: 07/03/2014, 04:20

7 529 0
pcr detection of microbial pathogens

pcr detection of microbial pathogens

... Buogo et al (43 ) Meer et al (44 )M Cryptococcus neoformans Escherichia coli (EHEC) Escherichia coli (EHEC) Tanaka et al (59)N Karch et al (45 ) Feng et al (46 )M Fach et al (42 )N Sachse apxIVA (toxin) ... symptoms, represents a considerable advantage and allows necessary control measures to be taken at an earlier stage Similarly, asymptomatic animals harboring and shedding the pathogen are also more likely ... strand separation temperature of DNA, thus facilitating amplification (73) 5.5 Polymers PEG and dextran are polymers that can be used as amplification facilitators It was shown that PEG can facilitate...

Ngày tải lên: 11/04/2014, 10:01

321 274 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

... P, et al.: A compendium of gene expression in normal human tissues Physiol Genomics 2001, 7(2):97-1 04 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression ... the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) have ... SDHA PP 1A GAPDH PGK1 PP 1A GAPDH SDHA 4th 5th 6th 7th 8th 9th 10th TBP B2M 18sRNA EEF1G PGK1 SDHA BACT EEFIG PGK1 HMBS* B2M* SDHA BACT 18sRNA HMBS PP 1A PGK1 EEFIG GAPDH 18sRNA BACT SDHA BACT GAPDH...

Ngày tải lên: 18/06/2014, 18:20

5 482 0
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx

Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx

... Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon Amplification efficiency Average efficiency A1 9 5a A2 A3 98 93 96.2 A4 x 100 A4 y 95 A2 A3 93 93 97.7 A4 x 100 A4 y 100 ... The database and all sequence data are backed up to a secure tapebackup system in a different building three times a week The database will be made available free of charge to interested parties ... reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified as G Accuracy of the sequences...

Ngày tải lên: 19/06/2014, 08:20

9 445 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

... P, et al.: A compendium of gene expression in normal human tissues Physiol Genomics 2001, 7(2):97-1 04 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression ... the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) have ... SDHA PP 1A GAPDH PGK1 PP 1A GAPDH SDHA 4th 5th 6th 7th 8th 9th 10th TBP B2M 18sRNA EEF1G PGK1 SDHA BACT EEFIG PGK1 HMBS* B2M* SDHA BACT 18sRNA HMBS PP 1A PGK1 EEFIG GAPDH 18sRNA BACT SDHA BACT GAPDH...

Ngày tải lên: 20/06/2014, 01:20

5 574 0
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf

báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf

... Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon Amplification efficiency Average efficiency A1 9 5a A2 A3 98 93 96.2 A4 x 100 A4 y 95 A2 A3 93 93 97.7 A4 x 100 A4 y 100 ... The database and all sequence data are backed up to a secure tapebackup system in a different building three times a week The database will be made available free of charge to interested parties ... reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified as G Accuracy of the sequences...

Ngày tải lên: 20/06/2014, 04:20

9 442 0
Báo cáo y học: "Selective amplification of glucocorticoid anti-inflammatory activity through synergistic multi-target action of a combination drug" ppsx

Báo cáo y học: "Selective amplification of glucocorticoid anti-inflammatory activity through synergistic multi-target action of a combination drug" ppsx

... histologic evaluation of tarsal and phalangeal joints based on inflammatory infiltrate, pannus formation, and cartilage and bone degeneration The combination of prednisolone and dipyridamole achieved ... phalangeal joints as well as inflammation, pannus formation, and bone damage, as indicated by histologic analysis [see Figure S2 in Additional data file 1] In vivo safety assays The observed amplification ... 20:7108-7116 Abraham SM, Lawrence T, Kleiman A, Warden P, Medghalchi M, Tuckermann J, Saklatvala J, Clark AR: Antiinflammatory effects of dexamethasone are partly dependent on induction of dual specificity...

Ngày tải lên: 09/08/2014, 01:22

14 326 0
Báo cáo lâm nghiệp: "Amplification of root—fungus interface in ectomycorrhizae by Hartig net architecture" pot

Báo cáo lâm nghiệp: "Amplification of root—fungus interface in ectomycorrhizae by Hartig net architecture" pot

... intercellular space However, the hyphal area in close contact with the cortical cell is considerably larger with broadly dilated hyphae The surface of dilated hyphae is again enlargedl by compartmentation ... broadly dilated hyphae and the third from presumed separately growing hyphae Measurements from these models of area and perimeter of hyphal complex and length of hyphal walls are presented in Table ... measured with Mop-Videoplan, an analytic system (Zeiss-Kontron), using standard software The surface/volume ratios of the different systems were calculated on the basis of an average pm diameter...

Ngày tải lên: 09/08/2014, 04:20

4 229 0
Báo cáo y học: "Amplification of autoimmune disease by infection" potx

Báo cáo y học: "Amplification of autoimmune disease by infection" potx

... have evolved a way of migrating to such mucosal sites, perhaps by taking advantage of inflammatory cells that go there naturally A possible unintended sequel is that inflammatory cells may also ... sarcoma are singly or doubly infected with human herpesviruses and 6B Proc Natl Acad Sci USA 1997, 94: 7600-7605 Sada E, Yasukawa M, Ito C, Takeda A, Shiosaka T, Tanioka H, Fujita S: Detection of ... analysis of latent human cytomegalovirus J Virol 1999, 73 :48 06 -48 12 33 Halary F, Amara A, Lortat-Jacob H, Messerle M, Delaunay T, Houles C, Fieschi F, Arenzana-Seisdedos F, Moreau JF, Dechanet-Merville...

Ngày tải lên: 09/08/2014, 06:22

11 513 0
Báo cáo khoa học: "Real time PCR analyses of expression of E-cadherin, alpha-, beta- and gamma-catenin in human breast cancer for predicting clinical outcome" pps

Báo cáo khoa học: "Real time PCR analyses of expression of E-cadherin, alpha-, beta- and gamma-catenin in human breast cancer for predicting clinical outcome" pps

... actgaacctgaccgtacacatgccctcatctaatgtct Primers for human E-Cadherin ECADF8 cagaaagttttccaccaaag ECADZR actgaacctgaccgtacaaaatgtgagcaattctgctt Primers for human γ-catenin gCatF1 aacaagaacaaccccaagtt gCatZr actgaacctgaccgtacatagttacgcatgatctgcac ... α-catenin ACATENINF1 ACATENINZR caacccttgtaaacaccaat actgaacctgaccgtacaccttctccaagaaattctca Primers for human β-catenin BCATENINF8 agggattttctcagtccttc BCATENINZF actgaacctgaccgtacacatgccctcatctaatgtct ... 1991, 113: 173-185 Kadowaki T, Shiozaki H, Inoue M, Tamura S, Oka H, Doki Y, Iihara K, Matsui S, Iwazawa T, Nagafuchi A, : E-cadherin and alpha-catenin expression in human esophageal cancer Cancer...

Ngày tải lên: 09/08/2014, 07:21

6 303 0
Báo cáo y học: "Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries" pps

Báo cáo y học: "Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries" pps

... 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCxT and 5’-GATCGGAAGAGC GGTTCAGCAGGAATGCCGAG-3BioTEG (IDT, Coralville, IA, USA) where ‘x’ denotes a nuclease-resistant phosphorothioate linkage and ‘3BioTEG’ a biotin attached via a 15-atom ... Vaidya AB, Martin DM, et al: Genome sequence of the human malaria parasite Plasmodium falciparum Nature 2002, 41 9 :49 8-511 14 Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal ... Additional file 2) Isolation of biotin-adapter-ligated DNA fragments by streptavidin capture Non-phosporylated biotinylated Illumina adapters were prepared by annealing 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCxT...

Ngày tải lên: 09/08/2014, 22:23

14 346 0
Báo cáo y học: " Monitoring human cytomegalovirus infection with nested PCR: comparison of positive rates in plasma and leukocytes and with quantitative PCR" doc

Báo cáo y học: " Monitoring human cytomegalovirus infection with nested PCR: comparison of positive rates in plasma and leukocytes and with quantitative PCR" doc

... external primers 1a 5’-GGTCACTAGTGACGCTTGTATGATGA-3’, 1b 5’-GATAGTCGCGGGTACAGGGGACTCT-3’; the internal primers 2a 5’-AAGTGAGTTCTGTCGGGTGCT-3’, 2b 5’-GTGACACCAGAGAATCAGA GGA-3’ After initial denature ... Hernandez-Boluda JC, Clari MA, Remigia MJ, Furio S, Calabuig M, Tormo N, Navarro D: Quantification of DNA in plasma by an automated real-time PCR assay (cytomegalovirus PCR kit) for surveillance of active ... 13 Boeckh M, GallezHawkins GM, Myerson D, Zaia JA, Bowden RA: Plasma polymerase chain reaction for cytomegalovirus DNA after allogeneic marrow transplantation - comparison with polymerase chain...

Ngày tải lên: 12/08/2014, 04:20

7 324 1
Báo cáo khoa học: " Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples" pdf

Báo cáo khoa học: " Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples" pdf

... et al., 2005 Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Mazur & Machado, ... vgfF: CGCTGCTATGATAATCAGATCATT vgfR: GATATGGTTGTGCCATAATTTTTAT vgfF2: ACACGGTGACTGTATCCA vgfR2: CTAATACAAGCATAATAC Reference Fonseca et al., 1998 This study OVB2LF1: TCCCTGAAGCCCTATTATTTTTGT OVB2LR1: ... step, a pair of internal OPV primers (vgfF2: ACACGGTGACTGTATCCA and vgfR2: CTAATACAAGCATAATAC) were designed from alignment of the vgf sequences of Brazilian VACV strains (Drumond and others, data...

Ngày tải lên: 12/08/2014, 04:20

5 299 0
Báo cáo sinh học: "Rapid PCR detection of group a streptococcus from flocked throat swabs: A retrospective clinical study" ppsx

Báo cáo sinh học: "Rapid PCR detection of group a streptococcus from flocked throat swabs: A retrospective clinical study" ppsx

... (GAS) dnaseB assay dnaseB forward primer TGA TTC CAA GAG CTG TCG TG dnaseB reverse primer TGG TGT AGC CAT TAG CTG TGT T IAC TGATTCCAAGAGCTGTCGTGatcaatataacaaacacttgcatatatatact tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA ... tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA Slinger et al Annals of Clinical Microbiology and Antimicrobials 2011, 10:33 http://www.ann-clinmicrob.com/content/10/1/33 then heated at 100°C ... design and data collection and analysis DR and IM participated in the performance of the PCR assay and data analysis All authors contributed to the preparation of the manuscript All authors read and...

Ngày tải lên: 12/08/2014, 17:20

5 320 1
Báo cáo y học: "Serologic and PCR testing of persons with chronic fatigue syndrome in the United States shows no association with xenotropic or polytropic murine leukemia virus-related viruses" pot

Báo cáo y học: "Serologic and PCR testing of persons with chronic fatigue syndrome in the United States shows no association with xenotropic or polytropic murine leukemia virus-related viruses" pot

... CCGAGGTTCCCTAGGGTTTGTAAT XPOLIF TCCACCCCACCAGTCAGCCTCTCT XPOLIR AAGTGGCGGCCAGCAGTAAGTCAT XPOLP TTGATGAGGCACTGCACAGAGACC gag1 GagOF ATCAGTTAACCTACCCGAGTCGGAC GagOR 0.25 μg DNA; 40 cycles of 94 C for 30 ... GCCGCCTCTTCTTCATTGTTCTC GagIF GagOR Probe 41 9 to 1 149 GGGGACGAGAGACAGAGACA CAGAGGAGGAAGGTTGTGCT XGagP2 ACCTTGCAGCACTGGGGAGATGTC gag2 Forward AGGTAGGAACCACCTAGTYC Probe 1581 to 17 64 RNA from 62 μL RT-PCR using AgPath-ID ... for 45 s for both primary and nested PCR [9] Reverse GGTGGAGTCTCAGGCAGAAAA Probe [6FAM] TGTTCCAGGGGGACT GGCAAGGTACCAccctgg [DABC]2,3 pol2 CCGTGCCCAACCCTTACAACCTCT XPOLOF XPOLOR CCGAGGTTCCCTAGGGTTTGTAAT...

Ngày tải lên: 13/08/2014, 01:20

7 278 0
Báo cáo sinh học: "Long telomeres in the polytene chromosomes of Drosophila melanogaster are associated with amplification of subtelomeric repeat sequences" doc

Báo cáo sinh học: "Long telomeres in the polytene chromosomes of Drosophila melanogaster are associated with amplification of subtelomeric repeat sequences" doc

... Quant Biol 42 , 1 041 -1 046 Tikhomirova M1VI, Belyatskaya OYa (1980) Modifying effect of extremal temperature depending on the organism adaptation to this factor on the action of radiation I Characterization ... squashes prepared (Atherton and Gall, 1972) with minor modifications was In situ by standard procedure hybridization Polytene chromosomes of salivary glands of D larvae were prepared ac-osophila ... subtelomeric repeat designated Dm665 (Danilevskaya et al, 19 84) Parallel hybridizations with Dm665 and A1 7 probes were performed on salivary from the same larva More intense hybridizations of the same telomeres...

Ngày tải lên: 14/08/2014, 20:20

10 298 0
w