... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG -3 ;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT -3 ;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG -3 ;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG -3 . The PCR solution was prepared in the buffer supplied with ... kit (GE Healthcare) and sequenced. The gene for Ab(L1–42) was then produced by PCR using the primers Abstart and Ab42stop (5¢-CCTG CCGAGCTCCTATTAAGCGATCACAACGCCACCAA CCATCAG -3 ) and a sequence-verified...
Ngày tải lên: 18/02/2014, 13:20
... tsA58T Ag cDNA carry- ing the A4 38 V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG -3 and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC -3 for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... medulla and interstitial cells of the cardiac valve. Arrowheads indicate CD31-positive ECs (green). All micrographs are shown at the same magnification. Scale bar = 50 lm. A new method for mouse...
Ngày tải lên: 18/02/2014, 17:20
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
... times a week. The database will be made available free of charge to inter- ested parties. Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon A1 A2 A3 A4 x A4 y Amplification ... A4 y Amplification efficiency 95 a 98 93 100 95 Average efficiency 96.2 Genotype 1b Amplicon A1 x A1 y A2 A3 A4 x A4 y Amplification efficiency 100 100 93 93 100 100 Average efficiency 97.7 a Amplification ... isolate RNA from plasma/serum samples including guanidine thiocyanate denaturation plus phenol/chloroform extraction, the ZR Viral RNA Kit (ZYMO Research) and the QIAamp Viral RNA Mini Kit (Qiagen)....
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
... 0.0157 139 46 630 399 17 −0.01676 431 7587889 −0.061120 833 690 438 −0.08806901 532 58 93 −0.05682217 630 89 13 −0.0 135 1864 935 6740 18 0.0 134 51 438 22 037 7 0.05 039 3 631 010479 0.07 431 541 137 3 739 0.048485405849704 0.01 136 335 7 432 515 19 −0.0106 936 7 237 77 23 ... 0.0000875969 832 92 32 0.00010981870 935 7 0.000 630 5 937 64 138 0.0011481017272 83 0.0005997 133 52 933 −0.000096409825026 33 −0.000058 932 2 736 91 −0.00 035 5717 936 032 −0.000656467669958 −0.00 032 3254 739 076 0.0000829698 838 34 34 ... −0.061725 532 030 3 23 −0.0 138 1 832 4456679 18 0.0 138 675 837 030 75 0.052099069080072 0.08 038 14819 831 81 0.0 532 731 6949 933 4 0.011767529 430 927 19 −0.011069999914064 −0.042 736 331 042 533 −0.0676189502 235 05 −0.04 534 0098661654...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... 39 57 63, 10 pages doi:10.1155/2010 /39 57 63 Research Article A Novel Method for Improving Fairness over Multiaccess Channels Seyed Alireza Razavi and Ciprian Doru Giurc ˘ aneanu Department of Signal Processing, ... show the Average AME for the six methods which are compared. As it was already pointed out previously, OMA achieves always the maximum possible AME. We can notice from Figure 2(b) that SIC and TS ... 2 134 62. References [1] M. A. Maddah-Ali, A. Mobasher, and A. K. Khandani, “Fairness in multiuser systems with polymatroid capacity region,” IEEE Transactions on Information Theory, vol. 55, no. 5, pp. 2128–2 138 , 2009. [2]...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article A Computationally Efficient Method for Polyphonic Pitch Estimation" pdf
... filter bank, it is faster than any other filter-bank- based implementation. The Fast RTFI is also compared with transform-based implementations as follows. So as to use a constant-Q transform for a ... our method and the best method (team “RK”) was really minor, whereas our method was approximately 13 times faster than the best method (team “RK”). The algorithm has been implemented as Matlab ... banks. In addition, fast implementations of such filter banks can also further improve the computational efficiency. As a result, the overall approach is 3 times faster than real time on a standard...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên: 23/06/2014, 01:20
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf
Ngày tải lên: 28/06/2014, 22:20
Báo cáo toán học: "A construction method for complete sets of mutually orthogonal frequency squares" pdf
Ngày tải lên: 07/08/2014, 06:20
Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf
Ngày tải lên: 09/08/2014, 18:21
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx
Ngày tải lên: 10/08/2014, 11:20
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 5 pdf
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "Immobilized pH gradient-driven paper-based IEF: a new method for fractionating complex peptide mixtures before MS analysis" pdf
Ngày tải lên: 13/08/2014, 13:20
Tài liệu English for Business (Lesson 3) pdf
... c a Edward. Kate: Good afternoon, Hale and Hearty Foods. Kate speaking. Edward: Ah yes, could I speak to Harvey Judd please? Kate: May I ask who‟s calling? Edward: It‟s Edward Bono. Kate: ... Kate: Harvey‟s on another call at the moment. Do you mind holding? Edward: Sure. Kate: I‟m afraid that line is still busy. Are you still happy to hold? Edward: Actually, could you ask Harvey ... catch that… Xin lỗi, tôi nghe ch a được rõ lắm… Edward: It's Edward from Dazzling Displays. Edward ở Công ty Triển lãm Dazzling. Vì ch a nghe rõ lời tự giới thiệu c a Edward nên Kate...
Ngày tải lên: 12/12/2013, 22:15
Tài liệu Bullentin for toefl part 3 pdf
... Inupiaq 450 Italian 33 1 Japanese 33 2 Javanese 33 5 Kannada 121 Kanuri 33 8 Kashmiri 33 9 Kazakh 31 0 Khmer 142 Kikuyu 1 23 Kinyarwanda 35 2 Konkani 34 0 Korean 34 2 Kurdish 35 9 Kurukh 604 Kusaiean 34 3 Lao 452 ... Macau 34 8 Macedonia, Former Yugoslav Republic of 35 0 Madagascar 35 5 Malawi 36 0 Malaysia 36 1 Maldives 36 3 Mali 36 5 Malta 36 8 Marshall Islands 36 6 Martinique 36 9 Mauritania 37 0 Mauritius 37 5 Mexico 107 ... Kuwait 32 3 Kyrgyzstan 32 5 Lao, People’s Democratic Republic 32 8 Latvia 33 0 Lebanon 33 3 Lesotho 33 5 Liberia 34 0 Libyan Arab Jamahiriya 34 3 Liechtenstein 34 4 Lithuania 34 5 Luxembourg 34 7 Macau 34 8...
Ngày tải lên: 13/12/2013, 22:15
Tài liệu Building a Cisco Network for Windows 2000 P1 pdf
... ATM 33 1 WAN Link Considerations with Windows 2000 33 2 Routing and Scalability 33 3 Planning for the Future Growth of the Company’s Infrastructure Network Scalability 33 4 Layer 2 Switching 33 5 Layer ... 31 9 Topology 32 1 Application Services 32 3 Server Farm Placement 32 4 Positioning Servers 32 4 Terminal Services Farms 32 5 LAN and Switching Considerations 32 6 Scaling Bandwidth 32 6 Scaling Considerations 32 6 IP ... was a teenager. He didn’t have a TV, or a telephone, or a car, or a refrigerator, or a washing machine, or running water aside from that at a hand-pumped well. By the time he was my age (mid -30 s),...
Ngày tải lên: 23/12/2013, 01:16
Tài liệu Dividend Stocks For Dummies Part 3 pdf
... properties and its management’s expertise. Such a company may be well positioned to take advantage of any recovery in the real estate market. Of course, a REIT that pays a sizeable dividend and has a ... laissez-faire attitudes about keeping rates affordable for customers tend to allow utilities to charge higher rates — bad for consumers, but good for shareholders. Florida, Texas, and California ... potential for capital appreciation, purchasing them at bargain prices, and then managing the properties for maximum profit- ability. The managers who performed well during the real estate melt- down...
Ngày tải lên: 21/01/2014, 23:20
Bạn có muốn tìm thêm với từ khóa: