... primers: Aba, 5¢-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG -3 ;Abb, 5¢-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT -3 ;Abc, 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab-
start, ... 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC -3 ;Ab-
start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG -3 ;Abstop, 5¢-CCTGCCGAGCTCCTATTA
CACAACGCCACCAACCATCAG -3 .
The PCR solution was prepared in the buffer supplied
with ... kit (GE Healthcare) and sequenced.
The gene for Ab(L1–42) was then produced by PCR
using the primers Abstart and Ab42stop (5¢-CCTG
CCGAGCTCCTATTAAGCGATCACAACGCCACCAA
CCATCAG -3 ) and a sequence-verified...
... tsA58T Ag cDNA carry-
ing the A4 38 V mutation were PCR-amplified from COS-7
cDNAs using the following primers: LTA-1F, 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG -3 and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC -3 for ... organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and Hirotake ... medulla and interstitial cells of the cardiac valve. Arrowheads indicate CD31-positive ECs (green). All micrographs are shown
at the same magnification. Scale bar = 50 lm.
A new methodfor mouse...
... times a week.
The database will be made available free of charge to inter-
ested parties.
Table 7: Amplification efficiency for patients' amplicons
Genotype 1a
Amplicon A1 A2 A3 A4 x A4 y
Amplification ... A4 y
Amplification efficiency 95
a
98 93 100 95
Average efficiency 96.2
Genotype 1b
Amplicon A1 x A1 y A2 A3 A4 x A4 y
Amplification efficiency 100 100 93 93 100 100
Average efficiency 97.7
a
Amplification ... isolate RNA from
plasma/serum samples including guanidine thiocyanate
denaturation plus phenol/chloroform extraction, the ZR
Viral RNA Kit (ZYMO Research) and the QIAamp Viral
RNA Mini Kit (Qiagen)....
... 39 57 63, 10 pages
doi:10.1155/2010 /39 57 63
Research Article
A Novel Methodfor Improving Fairness over
Multiaccess Channels
Seyed Alireza Razavi and Ciprian Doru Giurc
˘
aneanu
Department of Signal Processing, ... show the Average AME for the six
methods which are compared. As it was already pointed
out previously, OMA achieves always the maximum possible
AME. We can notice from Figure 2(b) that SIC and TS ... 2 134 62.
References
[1] M. A. Maddah-Ali, A. Mobasher, and A. K. Khandani,
“Fairness in multiuser systems with polymatroid capacity
region,” IEEE Transactions on Information Theory, vol. 55, no.
5, pp. 2128–2 138 , 2009.
[2]...
... filter bank, it is faster than any other filter-bank-
based implementation. The Fast RTFI is also compared with
transform-based implementations as follows.
So as to use a constant-Q transform fora ... our method and the best
method (team “RK”) was really minor, whereas our method
was approximately 13 times faster than the best method
(team “RK”). The algorithm has been implemented as
Matlab ... banks. In addition,
fast implementations of such filter banks can also further
improve the computational efficiency.
As a result, the overall approach is 3 times faster than
real time on a standard...
... c a Edward.
Kate: Good afternoon, Hale and Hearty Foods. Kate speaking.
Edward: Ah yes, could I speak to Harvey Judd please?
Kate: May I ask who‟s calling?
Edward: It‟s Edward Bono.
Kate: ...
Kate: Harvey‟s on another call at the moment. Do you mind holding?
Edward: Sure.
Kate: I‟m afraid that line is still busy. Are you still happy to hold?
Edward:
Actually, could you ask Harvey ... catch that…
Xin lỗi, tôi nghe ch a được rõ lắm…
Edward:
It's Edward from Dazzling Displays.
Edward ở Công ty Triển lãm Dazzling.
Vì ch a nghe rõ lời tự giới thiệu c a Edward nên Kate...
... ATM 33 1
WAN Link Considerations with Windows 2000 33 2
Routing and Scalability 33 3
Planning for the Future Growth of the Company’s
Infrastructure Network Scalability 33 4
Layer 2 Switching 33 5
Layer ... 31 9
Topology 32 1
Application Services 32 3
Server Farm Placement 32 4
Positioning Servers 32 4
Terminal Services Farms 32 5
LAN and Switching Considerations 32 6
Scaling Bandwidth 32 6
Scaling Considerations 32 6
IP ... was a teenager. He didn’t have a TV,
or a telephone, or a car, or a refrigerator, or a washing machine, or
running water aside from that at a hand-pumped well. By the time
he was my age (mid -30 s),...
... properties and its management’s expertise. Such a company
may be well positioned to take advantage of any recovery in the real estate
market. Of course, a REIT that pays a sizeable dividend and has a ...
laissez-faire attitudes about keeping rates affordable for customers
tend to allow utilities to charge higher rates — bad for consumers, but
good for shareholders. Florida, Texas, and California ... potential for capital appreciation, purchasing them
at bargain prices, and then managing the properties for maximum profit-
ability. The managers who performed well during the real estate melt-
down...