a model for the regulation of epigenetic risks

... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... SEASONAL MONITORING PROGRAM 4.1 Data Acquisition The first and foremost important task for this research was the collection of the required data that could be used for the data analysis The Transportation ... Transportation Research Board (TRB) of the National Research Council, under the sponsorship of the Federal Highway Administration (FHWA) and with the cooperation of the American Association of State...

Ngày tải lên: 04/07/2016, 17:20

... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... together such that the final output takes the uncertainty in both steps together The approaches proposed by Ramshaw & Markus and Cardie&Pierce are deterministic and local, while Argamon, Dagan...

Ngày tải lên: 08/03/2014, 05:20

... wave  breaking  on  a natural  beach  To  verify  the accuracy  of the numerical  model on  the simulation  of the wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in  ... suitable  for a practical  application.  On  the other hand, based on results of Nadaoka et al  [9], Ting and Kirby [15‐17], it can be estimated  that  in  the surf  zone,  the time  scale  ... wave  dynamics  in  the near  shore  area  and  in  the vicinity  of coastal  structures.  It  has  been  found  that  the numerical  model can  satisfactorily  simulate  the wave  transformation, ...

Ngày tải lên: 28/03/2014, 15:20

... snoitaraperp eniccaV sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi ... tneiciffeoc noitalerroC sisylana lacitsitatS )ASU ,eciveD raluceloM( redaer ASILE na gnisu mn 504 ta derusaem saw eulav D.O eht ,erutarepmet moor ta noitabucni fo nim 02 retfA etalp eht ot )ASU ,daR-oiB( ... yassa nietorp ACB a gnisu derusaem erew elpmas hcae fo snoitartnecnoc nietorp latoT sisylana tneuqesbus rof Co02− ta derots dna detcelloc erew stnatanrepuS Co4 ta nim 01 rof g 000,21 ta noitagufirtnec...

Ngày tải lên: 07/08/2014, 18:21

... statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA, USA) and expressed as mean ± SEM Groups of data were compared by analysis of variance; the means of groups with variances ... in RA synovitis, because most of the leukocytes infiltrating the SF of rheumatoid joints are PMNs PMNs in the RA SF are in an activated state, and produce a variety of other inflammatory mediators ... angiogenic factor, namely vascular endothelial growth factor, was markedly induced by the interaction of FLS with synovial leukocytes via the integrin/ICAM-1 pathway [19] Taken together, these data support...

Ngày tải lên: 09/08/2014, 01:21

... depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... size of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head...

Ngày tải lên: 11/08/2014, 20:21

... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... shifting the mean value above the corresponding mean value of the untreated cultured tumor samples Therefore, the median values are also given in Table The general expression levels of caspase-3...

Ngày tải lên: 12/08/2014, 15:20

... detail of 5-year age bands, the analysis of a single age group resulted in nearly identical ICERs as that of the 5-year age group it falls within For example, if a vaccination strategy was applied ... underestimated The underestimation of costs does have the advantage that it does not favour the vaccine arm and therefore represents a conservative approach A sensitivity analysis which varied all health ... current lack of available data, the model may underestimate the potential health benefits and cost savings resulting from vaccination Therefore future analyses, in the form of additional retrospective...

Ngày tải lên: 13/08/2014, 11:22

... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...

Ngày tải lên: 13/08/2014, 16:21

... enhancer and scans along the DNA until it reaches the promoter (Blackwood and Kadonaga 1998) In the chromatin remodeling model, factors that bind the enhancer can propagate a change in the chromatin ... c-Fos and c-Jun (Clayton, Rose et al 2000) Protein phosphatase appears to be the histone H3 phosphatase and two kinases of the Aurora/AIK family, Aurora -A and Aurora-B, have been identified as the ... phosphate (NADPH) oxidase (Castro and Freeman 2001) The NADPH oxidases are a group of plasma membrane-associated enzymes that catalyze the production of reactive oxidants such as free radicals by the...

Ngày tải lên: 24/08/2014, 12:22

... overview of a patient's asthma control with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and ... 1) In Navajo asthma patients, perceptions of asthma and beliefs about the activity of asthma medications influence when and how often asthma medicines are taken, as well as the use of health services ... within the health centers The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management Plan, and Asthma Action Plan),...

Ngày tải lên: 14/02/2014, 13:20

... former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other in several different respects, so that the actual factor ... et al., 2006) Another major difference among the three studies is the task that participants were asked to perform Kawabata and Zeki (2004) asked their participants to rate the beauty of the ... encompasses the region identified by Vartanian and Goel (2004), and has been related with the assessment of the relevance of motivational and emotional information and the regulation of emotional...

Ngày tải lên: 19/02/2014, 17:20

... estimates the quality of an automatic summary a ∈ A, given a set of models M and a similarity metric x An obvious first attempt would be to compute the average similarity of a to all model summaries ... inequality) or decreasing the similarity between automatic summaries (the x (a, a ) factor in the inequality) Finally, adding elements to A can only increase the chances of finding a pair of automatic ... framework, QARLA, that addresses such issues Given a set of manual summaries and another set of baseline summaries per task, together with a set of similarity metrics, QARLA provides quantitative measures...

Ngày tải lên: 17/03/2014, 05:20

... since the parser has to simultaneously perform two tasks: Searching for a path to be analysed and analysing it as well If the analysis procedure is too liberal, it may already accept and analyse an ... semantic predicates, a list of scopal constraints, syntactic, prosodic and pragmatic information as well as tense and aspect and sortal information An example of a VIT for the sentence Montag ... length of the temporal interval an analysis spans; an analysis with a greater length is preferred The coverage of an analysis is the sum of the lengths of the component analyses it consists of Note...

Ngày tải lên: 17/03/2014, 07:20

Ngày tải lên: 19/03/2014, 00:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... often the case that a grammar assigns just one of a range of logically equivalent representations to a sentence; designers of grammars for use in analysis generally take care to ensure that the ... translation application Similarly, the transfer rules of Zajac (1990) express a relation between subparts of a single complex structure Such an approach does not appear suitable for the appl/cation ... An alternative is to define equivalence classes of representations, and reduce all members of a class to the single canonical form which the grammar can map into a senfence Exactly how the classes...

Ngày tải lên: 01/04/2014, 00:20

... documents and metadata; 64 Presentation by Trajko Veljanoski, President of the Assembly of the Republic of Macedonia, and Jani Makraduli, Vice President of the Assembly of the Republic of Macedonia, at ... on the other end of the spectrum, many parliaments lack a strategic plan, an adequate ICT infrastructure, basic tools for Members of Parliament and staff, systems for managing documents and trained ... e-democracy The thesis will provide a critical analysis of e-parliament strategies in some countries’ parliaments Further, through an analysis of some of the countries’ parliaments that have e-parliament...

Ngày tải lên: 10/05/2014, 16:26

... retransplantation despite acyclovir therapy Liver Transpl 2005, 11:1289-1294 Halford WP, Halford KJ, Pierce AT: Mathematical analysis demonstrates that interferons-beta and -gamma interact in a ... Analysis of numerical data was performed with the software packages Microsoft Excel and Modstat (Modern Microcomputers, Mechanicsville, VA) All viral titers were transformed by adding a value of to the ... based on one-way ANOVA and Tukey's post hoc t-test b The Stat is not essential for the early synthesis of HSV-1 latency-associated transcripts A subset of neurons synthesize LAT RNAs as soon as...

Ngày tải lên: 20/06/2014, 01:20