a microscopic view by femtosecond raman induced kerr effect spectroscopy

... Amblyseius sojaensis Ehara (Acarina: Phytoseiidae) Applied Entomology and Zoology 23:45-51 Osakabe, M., K Inoue, W Ashihara 1987 Effect of Amblyseius sojaensis Ehara (Acarina: Phytoseiidae) as ... population dynamics of the parasitoids and on what spatial scales these attractants can cause increases in colonization Some natural enemies have also found to be attracted to volatile plant chemicals ... because of a radical reduction in their obligatory host Altering planting and cutting dates can ameliorate these disturbances By leaving strips of unmowed alfalfa, aphids and parasitoids are...

Ngày tải lên: 09/04/2015, 17:28

... used by Harmse (1989) depended on the researcher’s judgement and the availability of data In processing the variables, she used multivariate analysis and the South African spatial system was demarcated ... during a study of spatial economic development of a national spatial economic system (Harmse, 2001: 230) The last aspect that the geographer must address is the strategies that are available for alleviating ... modernisation paradigm (classical paradigm) and dependence paradigm At the beginning of the 21st century other development paradigms, such as the neoliberal approach and the neo populist approach, are...

Ngày tải lên: 20/02/2014, 16:20

... against actinic light by a copper sulfate solution The amount of synthetized ATP was evaluated by adding 10–25 nM standard ATP ATP synthesis induced by acid-base transitions Acid-base driven ATP ... enzymatic rate are an increased rate of H+ release at the cytoplasmic side and a decreased rate of H+ release at the periplasmic side Particularly this last effect can presumably compensate for ... (Stratagene), based on linear PCR, using the following mutagenic oligonucleotides: 5¢-CGCGATGTATGCGC TCAAGATCCTCGTGGCC-3¢ and 5¢-GGCCACGAGG ATCTTGAGCGCATACATCGCG-3¢ The mutation introduced an additional...

Ngày tải lên: 21/02/2014, 03:20

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried ... Concentrations of iron and manganese in protein samples were determined by atomic absorbance with a Hitachi Z-9000 atomic spectrophotometer (Showa Woman’s University, Japan) by Professor F Yamakura...

Ngày tải lên: 21/02/2014, 01:21

... 8oals is c o n s t r a i n e d by t h e " p o t e n t i a l " of the language, i e by a semantic system w i t h f i n i t e l y many options One can o n l y want to say what can be said, and ... said in a reasonable amount o f time Clearly, " p l a n n i n g " for natural problem language processing is a very Important Purpose however, w i l l not explain everything one says Simple associative ... How near is near: a near specialist M.~.T Artificial I~telltgence Lab memo no 344, Cambrldge, Mass I t i s not enough - - or even always necessary - - to know where what o b j e c t s are; one...

Ngày tải lên: 08/03/2014, 18:20

... membrane was probed with monoclonal antiHSP90, nNOS and eNOS sera Assay of calpain activity Calpain activity was assayed as previously described [39] One unit was defined as the amount of enzyme causing ... calpain M Averna et al Scheme Binary and ternary complexes generated by HSP90, NOS and calpain CLP, calpain; CST, calpastatin remained associated with HSP90, resulting in the formation of ternary complexes ... two new bands showing an approximate molecular mass of 140 and 130 kDa Because, in these conditions, more than 50–60% of the 160 kDa band disappeared, whereas the total catalytic activity A B Fig...

Ngày tải lên: 23/03/2014, 07:20

... image set and (b) Bayer raw data Considering the four neighboring red and green images of Gc , the local variation and local similarity criteria are estimated as the same way in (10) and (13) by ... “Signal processing method and apparatus for producing interpolated chrominance values in a sampled color image signal,” US patent no 642 678, February 1987 [4] R Lukac, K Martin, and K N Plataniotis, ... piecewise constant along an edge since it inherits the characteristics of spectral and spatial correlations [24] From the relation between the CFA samples on a line, we expand the CFA sample relation...

Ngày tải lên: 21/06/2014, 08:20

... Hamiltonian For the second graph, take H = G Again all the vertex-deleted subgraphs of both H and H are Hamiltonian, yet this time H is also Hamiltonian.” A different problem than that proved by ... Encyclopedia of c c Mathematics and its Applications, 66 Cambridge University Press, Cambridge, 1997 [4] N Deo, F Harary and A. J Schwenk, An Eigenvector Characterization of Cospectral Graphs Having ... eigenvalues and main angles of its vertex deleted subgraphs This follows from a formula connecting characteristic polynomials of a graph and its complement and main angles (see, for example,...

Ngày tải lên: 07/08/2014, 06:20

... considerably shorter as the oppositeness relation can be directly associated with the dual polar graph The dual polar graph is distance-regular and hence we readily have the required information about ... every negative eigenvalue As the cliques of the oppositeness graph on generators of a polar space are precisely the partial spreads, we can now prove the main result Theorem 4.2 A partial spread in ... schemes, volume 84 of Cambridge Studies in Advanced Mathematics Cambridge University Press, Cambridge, 2004 [3] R C Bose and T Shimamoto Classification and analysis of partially balanced incomplete...

Ngày tải lên: 07/08/2014, 21:21

... spectra were measured at the local scale in sunlit and shaded areas in the crown and were used to derive MAR parameters Both radiation spectra and MAR parameters at the same locations were also ... 503 Figure Vertical variation of the mean and standard deviation of reflectance and transmittance of a leaf in PAR and Far Red domains Calculations were made on 32 mature leaves sampled close to ... PAR domain leaf reflectance showed little variations around a mean value of 0.10 whereas the transmittance ranged between 0.03 and 0.16 around a mean value of 0.07 The variability of leaf transmittance...

Ngày tải lên: 08/08/2014, 14:22

... was disregarded, ie, the analysis was made on simulated and measured data arranged independently in ascending order Third, the spatial pattern was taken into account by considering paired data, ... detrimental to the accuracy of the model DISCUSSION Variability in radiation available to the understorey There are at least two main reasons for spatial variability of radiation available to the understorey ... (Kuuluvainen and Pukkala, 1987; Pukkala et al, 1991) The aim of this paper is to assess the abilof a turbid medium model to evaluate the spatial variability of the transmitted radiation below a young...

Ngày tải lên: 08/08/2014, 18:21

... CCC GAA AAA CAA CCA CAC TGC-3’/antisense 5’-GAT GAG GAG GCT GAG GAG ACC-3’), and a 467 bp amplicons for the housekeeping genes GAPDH (sense 5’-TGG TGA AGG TCG GTG TGA AC-3’/antisense 5’-TTC CCA ... protein avarage Gender p-value average p-value avarage p-value average p-value avarage p-value average p-value 0.707 3.11 0.238 112.56 0.616 4.40 0.009 87.90 0.66 3.19 0.54 Male 29 83.10 Female 20 ... http://www.wjso.com/content/9/1/43 Page of 21 Hashida H, Takabayashi A, Tokuhara T, et al: Integrin alpha3 expression as a prognostic factor in colon cancer: association with MRP-1/CD9 and KAI1/CD82 Int J Cancer 2002,...

Ngày tải lên: 09/08/2014, 01:24

... Velasco P, Soengas P, Revilla P, Ordás A, Malvar RA: Mean generation analysis of damage caused by Sesamia nonagrioides (Lepidoptera: Noctuidae) and Ostrinia nubilalis (Lepidoptera: Crambidae) ... Spain Population dynamics and distribution Maydica 2007, 52:195-204 Kumar H, Mihm JA: Assessing damage by second-generation southwestern corn borer, Diatraea grandiosella (Dyar) and sugarcane ... Diatraea saccharalis (Fabricious) and development of sources of resistance in maize Maydica 1997, 42:59-71 Butrón A, Malvar RA, Revilla P, Soengas P, Ordás A: Rind puncture resistance in maize:...

Ngày tải lên: 11/08/2014, 11:21

... http://www.harmreductionjournal.com/content/7/1/14 Fotheringham AS, Brunsdon C, Charlton M: Quantitative Geography: Perspectives on Spatial Data Analysis London: SAGE Publications; 2000 Narcotics Division: Central Registry ... http://www.harmreductionjournal.com/content/7/1/14 Authors' contributions NSW conducted field study, collated the data, generated the maps, conducted all statistical analyses, and prepared the first draft ... [7] The overall median age of heroin users was high at 41, suggesting that a majority had taken on the habit for years, thus contributing to a high prevalence whereas the incidence has been on...

Ngày tải lên: 11/08/2014, 18:20

... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, CD88(forward): TCAAGGTGGTGGTGGCAGTG, CD88(reverse): GTGACGATGGCTCCAGGAAGG, P21(forward): AGCAGCGGAACAAGGAGTCAG, P21(reverse): ... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed...

Ngày tải lên: 13/08/2014, 09:20

... Similarly, in human studies, epinephrine has been shown to decrease fractional splanchnic blood flow [3], increase splanchnic oxygen utilization and CO2 production, and alter acid base balance In view ... decrease in splanchnic circulation In porcine models, epinephrine has been shown to cause a significant reduction in intestinal mucosal pH along with significant mucosal damage as early as the first ... therapy [4] However, some studies have suggested that these effects are transient [5] Previously, no large comparative trial had been performed Annane and colleagues conducted a double-blind randomized...

Ngày tải lên: 13/08/2014, 20:22

... potential to enhance the catch rates of targeted species as well as affect the overlap between target species and bycatch species at small spatial scales (Craig 2012; Craig and Bosman 2013) Aggregation ... zones may reduce available habitat for tropical pelagic fishes Nature Climate Change 2:33–37 Thomas, P., and M S Rahman 2012 Extensive reproductive disruption, ovarian masculinization and aromatase ... and spatial location) Spatial distributions of Atlantic Menhaden B tyrannus in estuaries are related to spatial gradients in phytoplankton biomass and possibly salinity and other environmental...

Ngày tải lên: 04/09/2015, 08:12

... northeast corner of the Arab world, Iraq overlooking across the south coast of the Arabian Gulf for distance of 60km, bordered by Kuwait and Saudi Arabia to the south and west, Jordan and Syria to ... Journal of Global and Planetary Change 52, 1–22, 2006 [7] Gerivani,H., Lashkaripour,G, R,.Ghafoori, M&Jalali,N The Source of dust storm in Iran: A case study based on geological information and Rainfull ... regions affected Internal reports of Soil Conservation and Watershed Management Research Institute (SCWMRI), Iran, 2008 [14] Belaal ,A, A & Bader,H,H.Change of Climate and Hydrology in Ninwaa Journal...

Ngày tải lên: 09/09/2015, 10:17

... Zhao J., Guo H Factor analysis and dynamics of water quality of the Songhua river in northeast China 144, 159, 2003 403 17 Tavakoli B., sabetraftar K Examination of area, population and population ... addition, the risk of NO3leaching is particularly high after the harvest, when plant uptake is low, but N-release as mineralization continues Fig (a- f) Spatial variation of water quality parameters ... collaboration during the field samplings We appreciate Dr Mahdi Habibi from SCWMRI for editing our manucript References APHA (American Public Health) Standard Methods of Water and Waste Water Analysis,...

Ngày tải lên: 28/05/2016, 11:28

... Localio AR, Weaver SL, Landis JR, Lawthers AG, Brenhan TA, Hebert L, Sharp TJ: Identifying adverse events caused by medical care: degree of physician agreement in a retrospective chart review Ann ... 1:296-305 Braithwaite RS, DeVita MA, Mahidhara R, Simmons RL, Stuart S, Foraida M: Use of medical emergency team (MET) responses to detect medical errors Qual Saf Health Care 2004, 13:255259 Kaplan LJ, ... Critical Care Vol 13 No Amaral and Shojania meeting to review each case in order to identify clinical deteriorations that had resulted primarily from problems in antecedent care Two previous...

Ngày tải lên: 25/10/2012, 10:06