... •• •• Marian Affarah Marcella Alsan Ala Alwan Ana Mar a Amaris Islene Araujo de Carvalho Martha del Socorro Arias Novoa Larry Bagley Emily Bahnsen Anna Barker Matthew Basilico Janine Barnaby John ... partnership in Rwanda: Comprehensive National Cervical Cancer Prevention Program and the Rwanda Task Force on Expanded Access to Cancer Care and Control 233 Afsan Bhadelia, Kathy Cahill Afsan Bhadelia, ... Global Access to Pain Relief Initiative, UICC Global Alliance for Vaccines and Immunization The Global Fund to Fight AIDS, TB and Malaria Global Health Council Harrington Memorial Hospital Harvard...
Ngày tải lên: 15/03/2014, 00:20
... coordination of study, manuscript drafting and approval SC data acquisition, manuscript drafting and approval BJ coordination of study, patient recruitment, manuscript drafting and approval AKA ... coordination of study, manuscript drafting and approval VL study design, data acquisition, analysis, manuscript drafting and approval Competing interests CP is a consultant to Algeta ASA Received: ... semiquantitative 18 F-fluoride PET and to compare with changes in biochemical markers including PSA as a tumour marker and ALP as a bone formation marker Methods This imaging study was performed as...
Ngày tải lên: 21/06/2014, 02:20
SETTLEMENT OF CONPLAINTS AND DENOUNCEMENT A METHOD TO ENSURE LEGISLATION AND DISCIPLINE IN VIETNAMESE STATE ADMINISTRATIVE MANAGEMENT AT RESENT
... corporate finance, banking financial check and audit, etc Auditing is a financial activity test, the operation and management of financial control by a state agency created, an organization, and an individual ... group, land for borrowing, land in connection with farms and plantation, land relating to army and police; whereas in the Highland provinces, the complaints and disputes focus on land management and ... thesis has analyzed and provided additional matters relating to complaints, denoucement, handling administration complaints, accusation, handling accusation, legislation, ensuring legislation and...
Ngày tải lên: 20/06/2015, 09:03
Báo cáo " A method to construct flood damage map with an application to Huong River basin, in Central Vietnam" pdf
Ngày tải lên: 05/03/2014, 16:20
Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf
... study area is part of Traffic flow data were provided by all national, provincial and municipal authorities in the study area and were linked to a digital map of all roads in the Netherlands (NWB), ... covariates age (continuous), gender, and average monthly income (continuous) as an indicator of neighborhood socio-economic status Individually available covariates (gender, age and BMI) were also ... circular buffer around the address All GIS calculations were conducted using ArcInfo (ESRI, Redlands, CA) Statistical analyses Participants with missing values on exposure variables and the covariates...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT D...
Ngày tải lên: 07/03/2014, 16:20
Promoting Student Health and Wellbeing: A guide to drug education in schools ppt
... implementing their local curricula, including drug education programmes E tipu te pakiaka tangata, Me te whakatō he purapura wairua Whakahaukūtia te whenua ki te waiora pūmau, Kia puta ko te Hauora ... and illegal drugs Using language symbols and texts • Understanding and interpreting label information • Critically evaluate scientific information • Understanding the language and impact of ‘describe’, ... education is located in the key learning area of mental health within the health and physical education learning area in the New Zealand Curriculum It is important that students engage in a range...
Ngày tải lên: 22/03/2014, 15:20
THE RELEVANCE OF FORENSIC ACCOUNTING TO FINANCIAL CRIMES IN PRIVATE AND PUBLIC SECTORS OF THIRD WORLD ECONOMIES: A STUDY FROM NIGERIA potx
... REFERENCES Adefila, J J., A S Kasum and T A Olaniyi: (2005), ‘The Global Endemic Nature of Financial Malpractices: An Analytical Appraisal.’ African Journal of Management, 1(1), pp11-20 Ajisebutu, A (2006), ... he said, include; bribes, cronyism and nepotism, political donations, kickbacks and artificial pricing and fraud of all kinds Fraud also has been classified into three to include; asset misappropriation, ... in investigative accounting The kind of organization, mentioned above which are common in Canada and United States of America, is said to be recently established FINANCIAL MALPRACTICES Williams...
Ngày tải lên: 29/03/2014, 14:20
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... partial charges of the iminoquinone were calculated using SPARTAN (Wavefunction Inc., Irvine, CA, USA); the entire protein (including iminoquinone) was then protonated and solvated, and energy minimized ... substrate benzylamine Again,aswithMADHandTSOX,anindicationasto whether H-transfer occurs classically or by quantum tunneling was gained by investigating the temperature dependence of the rates ... breakage in dopamine, tryptamine and benzylamine, and the relative KIEs, give important insight into the shape of the potential energy barrier separating reactants from products Although a fluctuating...
Ngày tải lên: 31/03/2014, 23:20
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
... and/ or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional ... and/ or assembly of data, data analysis and interpretation, manuscript writing; GMH: collection and/ or assembly of data, data analysis and interpretation, manuscript writing; CA: collection and/ or ... of data, data analysis and interpretation, manuscript writing; TP: conception and design of the study, collection and/ or assembly of data, data analysis and interpretation, manuscript writing;...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " A broadly applicable method to characterize large DNA viruses and adenoviruses based on the DNA polymerase gene" doc
... sequencing primers, a lower strand primerACGATTTSAGTGCCTTCGTAGATG and a upper strand primer-CATCTACGAAGGCACTSAAATCGT Data were assembled using MacDNASIS and sequences were edited by manual comparison ... of Ito and Braitwaite [1] and overlap regions designated as regions and by Villarreal et al [4] VanDevanter et al [5] used degenerate primers to the DNA polymerase gene of mammalian and avian ... sealed, incubated at 37°C, and candled daily Those eggs containing live embryos days later, were opened and the CAMs in the area of inoculation were examined CAMs containing plaques or similarly-suspicious...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa" pdf
... this article as: Chu et al.: AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa Journal of the International AIDS ... access to both cART and chemotherapy for patients with AIDS-associated KS KS is the most common HIVrelated malignancy and an important contributor to AIDS-related mortality Early diagnosis and improved ... Serraino D, Bellu F, Giacomin A, Donato A, Madeddu A, Vitarelli S, Fusco M, Tessandori R, Tumino R, Piselli P, Dal Maso L: Cancer incidence in people with AIDS in Italy Int J Cancer 2010 Gingues...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot
... parameters were all positively correlated to the parameters related to tree death after mass inoculation and negatively to that related to tree survival INTERPRETATION AND DISCUSSION 4.1 Variations ... allowing them to collect fungal isolates and to carry out the inoculation experiments in the forest They are also grateful to Jacques Garcia and Paul Romary (INRA, Ardon) for their technical help ... others by a narrow but still forested area For historical and management reasons, the whole forest is divided into many plots consisting on an average of about 25 and being separated from each others...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo lâm nghiệp: "Variations in seed and seedling responses to water stress in three provenances of Eucalyptus camaldulensis Dehnh" pptx
... several instances, it appeared the most adaptable provenance It occurs naturally on well-drained, sandy, infertile soils and is developing a reputation as an outstandingly successful provenance in ... to lanceolate) in shape Principal component analysis (Cooley and Lohnes, lings (Fig 3) Water stress reduced leaf area most in Katherine seedlings (Fig 4), and the provenances also differed in ... by water stress in Katherine seedlings Stressed Tennant Creek seedlings maintained a higher proportion of dry weight in leaves and least in stems and, in fertilised seedlings, those from Tennant...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
... Di Martino MJ, Meunier PC, Murihead KA, Hanna N: Methotrexate inhibits macrophage activation as well as vascular and cellular inflammatory events in rat adjuvant induced arthritis J Rheumatol 1988, ... adjuvant arthritic rats Clin Exp Rheumatol 1999, 17:553-560 40 Segawa Y, Yamaura M, Aota S, Omata T, Tuzuike N, Itokazu Y, Oka H, Tamaki H, Nakamura T: Methotrexate maintains bone mass by preventing ... day values with the day 22 values to illustrate these effects Arthritis also caused an increase in the stance time and the swing time from day onwards Administration of GS and of indomethacine,...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
... Acta Veterinaria Scandinavica 2008, 50:27 Introduction Human and canine malignant mammary tumors share some epidemiological and clinicopathological features Incidence in both species increases ... http://www.actavetscand.com/content/50/1/27 Patients were evaluated by clinical history and physical examination including mammary tumor measurement and inguinal and axillary nodes palpation, performed ... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt
... practice since the publication of recent safety data [20] Albumin-based fluids can propagate an acidosis by two mechanisms: they increase plasma albumin concentration, and most contain an abundant ... frequently in critically ill patients By partitioning the base deficit, we are in effect combining these two parameters into a single measurement that contains both quantitative and qualitative information ... was predominantly due to the alkalinising effect of hypoalbuminaemia (mean albumin effect on base deficit +2.9; Table 1) This is also shown in the histogram for BDalb (Fig 1a) , showing an alkalinising...
Ngày tải lên: 12/08/2014, 22:22
Báo cáo y học: "Very old patients admitted to intensive care in Australia and New Zealand: a multi-centre cohort analysis" pptx
... and hospital bed-days for patients aged ≥ 80 years for Australia and New Zealand (ANZ) from 2006 to 2015 ANZICS APD, Australian and New Zealand Intensive Care Society Adult Patient Database in ... aged ≥ 80 years from the Ausyears tralian and New Zealand Intensive Care Society Adult Patient Database 2001 to 2005 (a) Mean and standard deviation Acute Physiology and Chronic Health Evaluation ... [18-23] Accordingly, we interrogated the Australian and New Zealand Intensive Care Society Clinical Outcomes and Resource Evaluation (ANZICS CORE) Adult Patient Database (APD) to obtain information...
Ngày tải lên: 13/08/2014, 16:20
A research to assess community eco-tourism and suggestions of solutions fo sustainable tourism development in Van Don district - Quang Ninh province
... the man-made beautiful landscapes and what the nature favors to bestow on this land At Long Beach, tourists can beach and watch the small island mountain rising above the sea, feel the romantic, ... villages as Quan Lan, and Tran Khanh Du - who was a commander having a big credit in the battle against army of Zhang Wen Hu in Van Don, Cua Luc, giving important contribution to the victory in ... Mun forest Dominant plant species here include their wine (Caesalpiniaceae), tea (Theacea), Oil, Tram, Sen (Sapotacear) and many medicinal plants such as Three size, skin packaging team, who is...
Ngày tải lên: 16/03/2015, 17:35
Fusing indigenous knowledge and global best practices leads a way to global competitiveness in emerging economies source of china s conspicuous strength in solar and wind industry
... China China China China Taiwan Taiwan China Taiwan China China Source: Energytrend (2011) 8 www.energytrend.com 24 Table 2.4 Top 10 global solar module manufacturers in China (2011) Firm Capacity ... that spread to a vast land of 9.6 million square kilometre but yet represents a meagre internal PV market Table and lists the annual and cumulative installations of solar PV installations in ... Canadian Solar Trina Yingli Hanwha Solar One Solarworld Jinko Suneeg Sunpower Country 2400 2500 2000 1900 1700 1500 1400 1100 1000 1000 China China China China China China Germany China China...
Ngày tải lên: 08/09/2015, 22:11