a method for relating
Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx
Ngày tải lên :
08/03/2014, 06:20
... Shimo-tsuruma, Yamato-shi, Kanagawa-ken 242 Japan
{ uramoto, takeda } @trl. ibm. co.j p
Abstract
This paper describes methods for relating (thread-
ing) multiple newspaper articles, and for visualizing ... quantity of information available today
makes it difficult to search for and understand the
information that we want. If there are many related
documents about a topic, it is important to capture ... A Method for Relating Multiple Newspaper Articles by Using
Graphs, and Its Application to Webcasting
Naohiko Uramoto and Koichi Takeda
IBM Research, Tokyo Research Laboratory
1623-14...
- 7
- 419
- 0
Tài liệu The Cost of a Military Person-Year - A Method for Computing Savings from Force Reductions pptx
Ngày tải lên :
17/02/2014, 23:20
... of a military person-year is equal to a
metric called regular military compensation (RMC). RMC includes
average basic pay for each military grade, basic allowance for housing,
basic allowance ... on data for the last 50 years would
be only a starting point. e nature of modern warfare and modern casualty treatment
options have changed the ratio and cost of deaths and disabilities drastically. ... two boards of actuaries
after analysis of past data trends and comparisons to similar assump-
tions in other relevant federal programs and private plans. In cases
where the current rate is...
- 153
- 396
- 0
Tài liệu Báo cáo khoa học: "A Method for Measuring Machine Translation Confidence" docx
Ngày tải lên :
20/02/2014, 04:20
... that this process also refers to the inability of the multinational naval forces
wydyf an hdhh alamlyt ayda tshyr aly adm qdrt almtaddt aljnsyt alqwat albhryt
(a) Source phrase
Source POS and ... estimation for machine translation. Computational
Linguistics, 33(1):9–40.
Taro Watanabe, Jun Suzuki, Hajime Tsukada, and Hideki
Isozaki. 2007. Online large-margin training for statisti-
cal machine ... an hdhh alamlyt ayda tshyr aly adm qdrt almtaddt aljnsyt alqwat albhryt
He adds that this process also refers to the inability of the multinational naval forces
MT output
Source POS
Source
Target...
- 9
- 543
- 0
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
Ngày tải lên :
20/02/2014, 18:20
... grammatical
and n-gram based statistical language constraints, and uses
a robust parsing technique to apply the grammatical
constraints described by context-free grammar (Tsukada
et
aL,
97). ... the Error-Pattem-Database and String-Database
can be mechanically prepared, which reduces the effort
required to prepare the databases and makes it possible to
apply this method to a new recognition ... correcting
accuracy by changing algorithms and will also try to
improve translation performance by combining our
method with Wakita's method.
References
T. Araki et al., 93. A Method for Detecting...
- 5
- 588
- 0
Báo cáo khoa học: "A Method for Word Sense Disambiguation of Unrestricted Text" potx
Ngày tải lên :
08/03/2014, 06:20
... evaluating these
results, one should take into consideration that:
1. Using the glosses as a base for calculat-
ing the conceptual density has the advantage of
eliminating the use of a large ... Mihalcea and D.I. Moldovan. 1999. An au-
tomatic method for generating sense tagged
corpora. In
Proceedings of AAAI-99,
Or-
lando, FL, July. (to appear).
G. Miller, M. Chodorow, S. Landes, ...
Computational Linguistics.
J. Stetina, S. Kurohashi, and M. Nagao. 1998.
General word sense disambiguation method
based on a full sentential context. In
Us-
age of WordNet in Natural Language...
- 7
- 378
- 0
Báo cáo khoa học: "An Exact A* Method for Deciphering Letter-Substitution Ciphers" doc
Ngày tải lên :
17/03/2014, 00:20
... re-
trieval and data mining, in which case it is impor-
tant to be able to read through them automatically,
without resorting to a human annotator. The holy
grail in this area would be an application ... gray are unreachable.
The cell at (d) is filled using the trigram probabilities and the probability of the path at starting at (a) .
In all of the data considered, the frequency of
spaces was far ... 48th Annual Meeting of the Association for Computational Linguistics, pages 1040–1047,
Uppsala, Sweden, 11-16 July 2010.
c
2010 Association for Computational Linguistics
An Exact A* Method for...
- 8
- 350
- 0
Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot
Ngày tải lên :
23/03/2014, 20:20
... Association for Machine Translation in the Ameri-
cas, pages 193–205, Columbia, Maryland.
BLEU: a Method for Automatic Evaluation of Machine Translation
Kishore Papineni, Salim Roukos, Todd Ward, and Wei-Jing ... eval-
uations can take months to finish and in-
volve human labor that can not be reused.
We propose a method of automatic ma-
chine translation evaluation that is quick,
inexpensive, and language-independent,
that ... ig-
noring capitalization). In contrast, Candidate 2 ex-
hibits far fewer matches, and their extent is less.
It is clear that a program can rank Candidate 1
higher than Candidate 2 simply by comparing...
- 8
- 336
- 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
Ngày tải lên :
05/09/2013, 16:10
... Thus, in a process where air
and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the
adiabatic tunnel described before.
To clarify what has been ... adiabatic saturation temperature of air.
Air is cooled and humidified, gaining enthalpy.
c- Water is at the adiabatic saturation temperature of inlet air.
Air is cooled and humidified maintaining ... the air and water temperature reach the same
value, called “adiabatic saturation temperature”, being the process known as “adiabatic saturation”.
To define this temperature we can suppose a long...
- 28
- 652
- 0
A novel interval method for validating state enclosures of the
Ngày tải lên :
12/01/2014, 22:04
... (MVR) evaluation and advanced
interval methods (AIM) have been applied to evaluate the iteration formula (7), see Step 4, Section IV. In
VNODE, an interval Taylor series method with QR factorization ... II-C. Although they are fairly efficient for exactly known initial states and parameters, they
are sometimes insufficient for practical scenarios with uncertain but bounded initial states and parameters
which ... optimal, and adaptive controllers. For nonlinear systems, robustness analysis with respect
to uncertain initial states and parameters can be performed by calculating enclosures of all reachable
states....
- 12
- 373
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... primers: Aba, 5¢-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, ... 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA
CACAACGCCACCAACCATCAG-3¢.
The PCR solution was prepared in the buffer supplied
with ... enzyme, and contained Aba, Abb and Abcat
40 nm each, and the start and stop primers Abstart and
Abstop at 600 nm each, and 200 lm each of dATP, dCTP,
dGTP and dTTP. The product was separated from...
- 16
- 691
- 0
- a method for effective
- a pattern matching method for finding noun
- a method for word sense
- a method for correcting errors
- a view management method for mobile mixed reality systems
- a modern method for guitar volume 3 pdf
- a method for computing the effectiveness of an insecticide
- a method for disambiguating word senses in a large corpus
- a method for word sense disambiguation of unrestricted text
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2