a member of the amphibole group

... with the recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site ... yeast Pichia pastoris, catalyzed the degradation of a synthetic substrate containing a papain-cleavage site, as well as other proteins Moreover, a protein with strong proteolytic activity was ... supernatant containing rPhl p N showed strong degradation of the full-length allergen and accumulation of a truncated  15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal...

Ngày tải lên: 08/03/2014, 22:20

... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... although the kcat and Km values with ADHVII are approximately half the values found for ADHVI The catalytic efficiencies towards the oxidation of cinnamyl alcohol and several aliphatic alcohols are ... activity Cinnamaldehyde Phenylacetaldehyde Benzaldehyde Coniferaldehyde Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal 2-Methylpropanal 2-Methylbutanal 3-Methylbutanal...

Ngày tải lên: 31/03/2014, 08:20

... to the child that they cannot keep The first aider should ensure that that they or another adult are available to take care of the child The first aider should tell the child that they or another ... with the traumatised person The first aider should speak clearly and avoid clinical and technical language The first aider should communicate with the person as an equal, rather than as a superior ... that are available (for example, crisis lines and health centres) The first aider should be aware that the person may not remember all the details of the event The first aider should be aware...

Ngày tải lên: 11/08/2014, 16:22

... classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... ska visas här Agricultural subsidies are mainly governed by the AoA though the SCM is also applied in some cases That means the AoA and the SCM may even be in conflict The AoA may legally allow ... in Agriculture, 2003, P160-165 22 The Canada – Dairy, report of the Panel, supra n 19, para 4.310 and Canada – Aircraff, report of the Panel, supra n 36, para 5.27 18 Fel! Använd fliken Start...

Ngày tải lên: 18/08/2014, 12:35

... relationship to the library     A charity can exist without having registered charitable tax status There are a number of advantages: a) the organization may issue tax receipts; b) the organization ... Charitable Status immediately following adoption of the Constitution and By Laws Be aware that if your library already has charitable status, this may impact on your application Contact the Charities ... disadvantages of registration include the following: a) the organization must devote all of its resources to its charitable activities; b) the organization must make annual filings with Canada...

Ngày tải lên: 05/12/2016, 17:38

... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two ... located on the surface of the bacterium and is noncovalently attached to the outer membrane The extracellular localization is in accordance with the prediction of a signal peptide in a primary ... RT-PCR analyses revealed that this regulation takes place at the transcriptional level The concomitant regulation of SACCP and MopE is also in accordance with the possibility that the MCA2590 and...

Ngày tải lên: 23/03/2014, 11:20

... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA ... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... to calculate the Rfree The final R and Rfree values of the model are 0.21 and 0.22 for the complete data ˚ set up to 1.6 A The electron density of the whole main chain of the catalytic domain...

Ngày tải lên: 19/02/2014, 00:20

... phosphorylation states of Sch9p, as already demonstrated [21] Next, we investigated whether Bud32p is a substrate of Sch9p The HA-tagged Sch9p was immunoprecipitated by the use of the anti-HA affinity ... affinity matrix: Fig 7Ba confirms the immunoprecipitation of Sch9p (lane 1); as controls, the anti-HA matrix was incubated either with a cellular lysate of the untagged strain, or with no lysate (lanes ... for the endogenous kinase in the association with Grx4p, whereas a similar amount of the S25 8A mutant (lane 3) failed to bind Grx4p, as shown by a signal comparable to the background level (lane...

Ngày tải lên: 07/03/2014, 04:20

... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f sp Platani FEMS ... proteins clearly identifies a four-cysteine-containing cerato-platanin domain, and a blastp search always yielded the members of the cerato-platanin family as the best hits It is possible that they represent ... culture filtrates of Ceratocystis fimbriata f sp platani, in the cell walls of ascospores, hyphae and conidia of this fungus The authors suggested that cerato-platanin may have a similar role to...

Ngày tải lên: 07/03/2014, 12:20

... octanoate; C10, decanoate, C12, dodecanoate, C16, palmitate, BA, benzoate The data are means ± SD of triplicate assays transcripts for the SA and MACS1 genes are present only in the RE area of the ... H., Ioka, R.X., Kamataki, A. , Magoori, K., Takahashi, S., Sakai, J & Yamamoto, T.T (2001) Molecular identification and characterization of two mediumchain acyl-CoA synthetase, MACS1 and the Sa gene ... long-chain acyl-CoA synthetase (mVLACS), human long-chain acyl-CoA synthetase (hLACS1), mouse mediumchain acyl-CoA synthetase proteins (mSA, mMACS1, mKS, and mKS2), mouse acetylCoA synthetase (mAceCS1),...

Ngày tải lên: 08/03/2014, 02:20

... tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex aeolicus; Tt, Thermoanaerobacter tengcongensis ... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... sequence of Thermoplasma volcanium Proc Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai,...

Ngày tải lên: 16/03/2014, 16:20

... Tanigawa, Y (1995) Molecular cloning and characterization of a cDNA encoding monoclonal nonspecific suppressor factor Proc Natl Acad Sci USA 92, 3463–3467 10 Nakamura, M., Xavier, R.M & Tanigawa, ... of the 33.5 kDa Ubi-L adduct The 33.5 kDa Ubi-L adduct was digested by V8 protease and subjected to MALDI-MS analysis The data in the second column are the mass values obtained experimentally, ... between the C terminal of the glycine residue of Ubi-L and the lysine of Bcl-G The 33.5 kDa Ubi-L adduct was digested by V8 protease and subjected to MALDI-MS analysis The data in the first column are...

Ngày tải lên: 17/03/2014, 10:20

... Manitoba Central Animal Care breeding facility All procedures followed Canadian Council on Animal Care guidelines and were approved by the Animal Care Committee at the University of Manitoba Animals ... hypoxia for 36 h, with sense primer 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC-3¢ and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG-3¢ The PCR product was ligated to pGEM-T (Promega) ... Quantification of the western blot bands revealed a nine-fold increase of BNIP3 in KA-injected striatum There was a 3.5-fold increase in CL striatum of the injected animal as compared with striatum...

Ngày tải lên: 22/03/2014, 17:20

... used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ... between the two proteins, arguing against a major conformational change of the loop Structural data are available in the Protein Data Bank under the accession numbers 2QDZ (FhaCWT) and 3NJT (FhaCR45 0A) ... the b-barrel in both FhaCWT and the FhaCR45 0A variant Thus, our data strongly argue that the R45 0A substitution has no significant effect on the structure of the FhaC barrel and the POTRA domains,...

Ngày tải lên: 23/03/2014, 03:20

... (abolition of the signal) Response element SmFTZ-F1 SF-1 TCA AGGTCA ACA AGGTCA CCA AGGTCA GCA AGGTCA TGA AGGTCA TTA AGGTCA TAA AGGTCA TCT AGGTCA TCG AGGTCA TCC AGGTCA TCA GGGTCA TCA AGGTCC TCA ... was able to transactivate transcription of a reporter gene from the SFRE at a similar level to SF-1 in CV-1 cells This indicates that at least some of the mammalian coactivators are capable of ... lines MATERIALS AND METHODS Parasites A Puerto-Rican strain of S mansoni was maintained in Biomphalaria glabrata snails and golden hamsters (Mesocricetus auratus) Cercariae were released from infected...

Ngày tải lên: 23/03/2014, 21:20

... Loans Capital markets Share of capital market financing (r.h scale) Roadshow Mexico City, May 2014 © 2014 Holcim Ltd 25 Access to a wide range of capital markets – only CHF 0.9 bn of capital markets ... expected to remain flat overall as increases in Asia Pacific, Europe, North America, and Africa Middle East are offset by negative volumes in Latin America • Ready-mix concrete volumes also expected ... regulatory approvals: Holcim EGM approvals Launch public exchange offer REGULATORY APPROVALS SHAREHOLDER APPROVAL AND ACCEPTANCES TRANSACTION CLOSING EXPECTED IN H1 2015 38 Contact information and...

Ngày tải lên: 29/07/2014, 12:42

... mapping, Theorem improves Theorem To deal with the generalization of the most important and most difficult case of Theorem — that of small m + n — we make a simplifying assumption that R satisfies the ... estimate of Theorem has an analog even in the non-commutative case Theorem Let A, B ⊆ G be subsets of a finite group G of order q = |G|, and let R ⊆ A × B Suppose that m + n ≥ q + Then R r |A + ... be an injective mapping from A to B Suppose that m + n ≥ q + Then τ √ |A + B| > q − q − In a certain (rather narrow) range of m, n and in the particular case of R induced by an injective mapping,...

Ngày tải lên: 07/08/2014, 06:20

... standard basis of class functions that are zero in all classes that not contain an element of Cn Since each νd,n can be expressed as a linear combination of the χd,n , and vice-versa, and the ... Here, A is a product of fractions of the form ppsrd a for all a relatively prime to p Since d a the numerator and denominator of each of these fractions are units in Z/(ps ), all the fractions are ... #R23 Thus the χ∗ for d|n are a basis for the induced characters from Cn up to Sn By d,n Theorem and the last part of the proof of Lemma 10, Ψn,k can be expressed as a linear combination, as in (15)...

Ngày tải lên: 07/08/2014, 06:20

... we can see that the 0-Hecke monoid has N! elements, and that the 0-Hecke algebra has dimension N! as a vector space Additionally, the length of a permutation is the same as the length of the associated ... and expanded to generic finite Coxeter groups in [3] A more general approach to the representation theory can be taken by approaching the 0-Hecke algebra as a monoid algebra, as per [6] The main ... eigenvalues of a diagram demipotent are either or Proof Assign a total ordering to the basis of H0 (SN ) in the πi generators that respects the Bruhat order Then by Corollary 3.3, the matrix MD of any...

Ngày tải lên: 08/08/2014, 12:23

... The line graph, LG, for G is the multidigraph whose vertices are the edges of G and whose edges are (e, f ) with e+ = f − As with G, we have the Laplacian ∆LG and the critical group K(LG, ... [1] Andrew Berget, Andrew Manion, Molly Maxwell, Aaron Potechin, and Victor Reiner The critical group of a line graph arxiv:math.CO/0904.1246 [2] Alexander E Holroyd, Lionel Levine, Karola M´sz´ros, ... Further, in the case in which the out-degree of each vertex of G is a fixed integer k, we show the kernel of this surjection is the k-torsion subgroup of K(LG, e∗ ) These results appear as Theorem...

Ngày tải lên: 08/08/2014, 14:23