a mechanical approach to the ecology of animals and plants

... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...

Ngày tải lên: 07/03/2014, 09:20

... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... well-formed Also exemplary of the division of duty between the morphophonological parser and the syntactic parser is the dual status of subcategorization in Warlpiri For example, the ergative case suffix...

Ngày tải lên: 08/03/2014, 18:20

... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... name The three “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing ... amusing and have a nice ring to them As a matter of fact, it turns out that the name Eatalian is actually used by at least one real Italian restaurant located in Los Angeles, CA3 For the same set of...

Ngày tải lên: 23/03/2014, 14:20

... bread, blessed and broke it, and gave it to them, and said: “Take, this is my body.” And he took a cup, and when he had given thanks he gave it to them, and they all drank of it And he said to them, ... not only the Messiah and the Son of God but also the Son of Man who will be seated at the right hand of God and will come ‘with the clouds of heaven’ at the climax of history to gather in the elect ... religious and racial separation God’s reign here and hereafter was for all human beings The parables of Jesus show this universal horizon Even in the Parable of the Tax-collector and the Pharisee, the...

Ngày tải lên: 10/06/2014, 21:42

... Preface For reasons of temperament and training, I find it natural and exciting to make forays across what many scholars see as an unbridgeable divide between the humanities and the natural sciences ... things as religious, mystical, magical, and so forth within larger processes of meaning making and valuation (singularization), we are better able to analyze the contestations over the meaning and ... “religious” and then some We can consider specialness both behaviorally and substantively, asking if there are behaviors that tend to mark things off as special and if there are particular types of things...

Ngày tải lên: 11/06/2014, 12:43

... in the passband and the transition bands As the objective function to be minimised we adopt a particular representation of the group delay [20], while the stopband magnitude specifications of the ... except for the region next to the transition band The group delay in the passband and transition band is depicted in Figure 4(b) The group delay is again approximately constant with the mean value ... procedure the AFB and SFB prototype filters’ magnitude responses are matched in the passbands and the transition bands without further consideration of the overall FBP group delay, aiming at minimum,...

Ngày tải lên: 21/06/2014, 19:20

... is mapped onto one of the multiple NT antennas After filtering and amplification, the signals are launched into the wireless channel At the receiver, the signals are captured by NR antennas and ... clever way to extract information from this matrix without going into involved mathematical analysis The idea is to optimize the above scattering equation using a variation approach (11) together ... difference |rab ≡ |ra − |rb with a = b To make contact with the variational analysis given above, this difference can also be read as |rab = |ra + |δra Then compute the minimum of the distance |rab in...

Ngày tải lên: 22/06/2014, 19:20

... sequence a ∈ [q]Z , we have a( n) has a local maximum at k = (a has a local maximum at k) + 1Ak (a) , if k < n, and a( n) has a local maximum at n = (a has a local maximum at n) + 1An (a) + 1A n (a) ... manner to this context, so that LAn (a) = # local maxima of a + # local minima of a n−1 = (a has a local maximum at n) + (a has a local maximum at k) k=1 Now, the only difficulty in adapting the ... contains very recent contributions where mean and variance are obtained Let us just say that, to date, the proofs developed to solve these problems are of a combinatorial or analytic nature and...

Ngày tải lên: 08/08/2014, 12:23

... reviewed the manuscript, ACP participated in the study design and manuscript writing, JAF is responsible for the CARAT project and participated in all stages and tasks All authors have read and approved ... Luciano Margarida Trindade Rita Câmara Rodrigo Alves Additional file CARAT – Control of Allergic Rhinitis and Asthma Test This is a translation to English of the of the preliminary version of ... meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection,...

Ngày tải lên: 12/08/2014, 14:20

... heparin administration as rapidly as necessary? How can dosage of the drug be titrated to achieve maximal local effects without the risk of systemic complications? What is the adequate duration ... remains to be done The following questions need to be answered As the pro-coagulant state in the alveolar space begins in the early phases of ALI, how can it be assessed in order to initiate ... Critical Care Vol 12 No Suter The translation of a potentially beneficial effect of inhaled heparin in experimental models of ALI to clinical practice has not yet been achieved; important additional...

Ngày tải lên: 13/08/2014, 11:22

Ngày tải lên: 23/03/2014, 05:22

... interest and taxes and the total assets of a bank 2.1.3 UNIVERSAL BANK According to Rose (1999), a bank is a financial institution that undertakes a broad variety of financial services; especially the ... financial organizations in Ghana, is a project undertaken by the Bank of Ghana, in association with other banks to bring the payment systems in Ghana to the best global standards The Ghana interbank ... neutral and 98% disagreed It was generally, accepted that ATMs attracts retail savers to the universal banks, and grants the customer a greater access to saved funds The bank executives were of the...

Ngày tải lên: 10/12/2016, 17:16

... it, and (3) the most suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the ... signal is stored in GS and the tag t is placed in the normal position of the target T for final printout ILLUSTRATION As an example of the performance of this section of the program, we offer the text ... criteria, this fact would be indicated by the failure signal and by the notations of the error types encountered On the other hand, the satisfaction of the criteria is no guarantee that the result...

Ngày tải lên: 16/03/2014, 19:20

... to the names of animals Names of animals are familiar with the life of people We observe them and find their characteristics, habits Each of animals has its typical character Basing on typical ... typical of the animal II.1 Domestic animals A domestic animal is animal kept for companionship and enjoyment or household animal, as opposed to wild animals or to livestock, laboratory animals, ... is the most widely used of many animals and is usually harvested by shearing Sheep continue to be important for wool and meet today and are also occasionally raised for pelts, as dairy animals...

Ngày tải lên: 11/12/2013, 23:51

... analysis Analysis of processes and operations within the organisation to identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure ... the activities of the organisation Risk management enhances the understanding of the potential upside and downside of the factors that can affect an organisation It increases the probability of ... terms of their potential to benefit the organisation The range of available risk response treatments include tolerate, treat, transfer and terminate An organisation may decide that there is also a...

Ngày tải lên: 21/02/2014, 12:20

... methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides were allowed The taxonomic search ... BLASTP-based protein database searching and functional classification All peptide sequence tags (Table 2) were searched against the dog genome database using BLASTP, version 2.2.16 Database size was ... match-set Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated...

Ngày tải lên: 07/03/2014, 06:20

... that it will walk away.’ Sem: ‘Kla goes out to seek Laay in the cane field and he finds that it is about to walk away.’ The sentence in (17) are split into two SVCs: the series of V1 to V3 and the ... variable quantification to resolve pro-forms and VP ellipses to their antecedents The variable quantification in TLG is comparable to the use of memory in storing antecedents and anaphora The verbs ... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers and the gaps are...

Ngày tải lên: 08/03/2014, 21:20

... scans, 512 K data points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum 1.1 ... pellet was discarded and a sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which ... was set to 2.2 A The cathode surface potential was )1 V and the anode potential was 10 V Both end-plate potentials of the ion trap were set at 1.5 V and the duration of the electron pulse was 100...

Ngày tải lên: 17/03/2014, 10:20

... into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative to a syntactic definition is a semantic one and the approach to se,manties which offers the ... is the guy at the door and the speaker and the relationship of the speaker having told the guy at the door to watch out The word but can be viewed as function mapping situation-types into situatiun-types ... st - and can be regarded as representing the Iocutionary aspect of the act The other gives the set of situation-types of the diseoursc situation (including author and reader or speaker and addressee)...

Ngày tải lên: 24/03/2014, 01:21

... Hague for other systems to which we can compare them We take this level of success as an indication of the feasibility of our data-driven, modular approach Additionally, our approach has the advantage ... Data The data on which the classifiers are trained and tested is an extract of 7915 sentences from the Penn Treebank (Marcus et al., 1993), which are tagged to indicate the location of WH gaps ... the VP node Finally, within the VP subtree it should predict the location of the gap as the last child of the parent VP SBARQ - begin at the first branching node dominating the WH operator, and...

Ngày tải lên: 24/03/2014, 03:20