a major regulator of ca2 i balance in cardiac cells
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
Ngày tải lên :
16/03/2014, 11:20
... TH activity in integuments of day penultimate (L5D2), day last instar (L6D0), and day last instar (L6D1) larvae (Inset) DDC activity in integuments from the same larval stages a* , Significantly ... suggesting that Ca2+ is a regulatory factor leading to optimal activation of the expression of both genes The next logical step was to find the principal agent causing cytoplasmic Ca2+ elevation in ... (Beckman-Coulter) In situ hybridization The DIG-labeled TH RNA probe was prepared using the Roche Biochemicals kit (Roche Molecular Biochemicals, Indianapolis, IN) Hybridization and washing were carried out as...
- 10
- 440
- 0
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf
Ngày tải lên :
12/08/2014, 03:20
... Y, Yoshida S, Taniguchi Y, Dubouzet JG, Yazaki K, Sato F: Identification of a WRKY protein as a transcriptional regulator of benzylisoquinoline alkaloid biosynthesis in Coptis japonica Plant Cell ... Seki M, Shinozaki K, Yamaguchi-Shinozaki K: Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early ... properties of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS Nucl Acids Res 1996, 24:3134 Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita...
- 12
- 182
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
Ngày tải lên :
23/03/2014, 07:20
... enzyme activity, indicating that Cys35 is involved in catalysis The Cys83Ala mutant shows only 1% of wild-type activity with TryX indicating that formation of an intramolecular disulde is important ... encoding proteins with homology to mammalian glutathione peroxidases A selenocysteine, a tryptophan and a glutamine residue form a catalytic triad in the active site in mammalian GPX4 and are ... Cys64Ala R-TDPX1 Cys64Ala F-TDPX1 Cys83Ala R-TDPX1 Cys83Ala TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC...
- 16
- 483
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
Ngày tải lên :
14/03/2014, 23:20
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... chemiluminescent film lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical ... phase distribution was analyzed by FACS (A) The fraction of cells in G1-phase was significantly increased in the miR-373 ASO group, and the fraction of cells in S-phase was significantly decreased...
- 11
- 396
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
Ngày tải lên :
30/03/2014, 04:20
... HIF- 1a stabilization and HIF-1 target gene transcription transient hypoxia, extracellular signal-related kinase ⁄ mitogen-activated protein kinases and phosphoinositide-3-kinase are not required ... least in endothelial cells, protein kinase A is involved in HIF- 1a phosphorylation under intermittent hypoxia but not under chronic hypoxia, and protein kinase A inhibition decreased the transcription ... therefore that it is its stabilization that is increased in these conditions [50] HIF- 1a stabilization does not always translate into HIF-1 activity One can therefore ask whether hypoxia periods interrupted...
- 12
- 390
- 0
Báo cáo y học: "Clinical Profiles of Chronic Hepatitis C in a Major County Medical Center Outpatient Setting in United States" pptx
Ngày tải lên :
08/08/2014, 18:20
... Center In these patients, 71.4% were minorities, including African American, Hispanic, and Asian patients, indicating that a high prevalence of HCV infection is also present in the minorities of ... discriminant score in diagnosing cirrhosis, the clinical diagnosis was further assessed in 79 patients who had pathological diagnosis Compared to pathological diagnosis, the sensitivity and specificity ... prothrombin time (PT), and ALT/AST ratio A score of higher than is the criteria for diagnosing cirrhosis The specificity of the discriminant score in diagnosing advanced fibrosis or cirrhosis was reported...
- 9
- 388
- 0
Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx
Ngày tải lên :
12/08/2014, 01:21
... testing, inappropriate use of antimicrobials and to arrest intrafamilial spread of EV infection [2,15] There is no information on the role of EVs causing AM in Kuwait or other adjoining countries ... 33 in Ulaanbaatar and Tov province, Mongolia, intrafamilial spread, and risk factors for infection Epidemiol Infect 2005, 133:1131-1142 Dalwai A, Ahmad S, Pacsa A, Al-Nakib W: Echovirus is an important ... and association with clinical findings J Med Virol 2002, 66:224-228 Bahri O, Rezig D, Nejma-Oueslati BB, Yahia AB, Sassi JB, Hogga N, Sadraoui A, Triki H: Enteroviruses in Tunisia: virological...
- 6
- 285
- 0
Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit
Ngày tải lên :
13/08/2014, 18:22
... recently available at the time [14] The unit of analysis is a hospitalization, and it is possible that an individual patient contributes more than one hospitalization to the database in any given year ... leading ICD-9-CM diagnoses in children hospitalized with a principal diagnosis of mood disorder as a percentage of all hospitalizations with a principal diagnosis of mood disorder, 2006 Diagnosis ... stays in psychiatric units within general hospitals are included Information provided in the KID includes principal and secondary diagnoses, principal and secondary procedures, admission and discharge...
- 9
- 449
- 0
Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf
Ngày tải lên :
13/08/2014, 21:21
... of Emergency Physicians; Canadian Critical Care Society; European Society of Clinical Microbiology and Infectious Diseases, et al: Surviving Sepsis Campaign: international guidelines for management ... JS, Zimmerman JL, Vincent JL, Page of International Surviving Sepsis Campaign Guidelines Committee; American Association of Critical-Care Nurses; American College of Chest Physicians; American ... reverse transcriptase inhibitors (NRTI) plus a protease inhibitor (PI) or a nonnucleoside reverse transcriptase inhibitor (NNRTI) or a PI and an NNRTI in combination [20] As adherence is a major component...
- 8
- 409
- 0
Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx
Ngày tải lên :
14/08/2014, 08:20
... [48] Data were loaded into a MySQL database for subsequent querying Additional data files The following additional data are available with the online version of this paper Additional data file ... propose a new strategy to estimate the rate of gene duplication A major obstacle to the estimation is difficulty in minimizing the effect of gene conversion while taking large families into account ... used in previous studies consider gene duplication as a single entity, ignoring the fact that gene duplication is actually achieved by multiple mechanisms Major mechanisms of gene duplication are...
- 11
- 357
- 0
Báo cáo y học: "bEstrogen, not intrinsic aging, is the major regulator of delayed human wound healing in the elderly" docx
Ngày tải lên :
14/08/2014, 08:21
... an imbalance in which may explain the dramatic increase in inflammation and decrease in matrix deposition in the aged Aging-associated probe sets within our enriched data set were identified ... serine peptidase inhibitor, Kazal type Anti-inflammatory/anti-microbial 3.8E-05 -14.4 211906_s_at SERPINB4 serpin peptidase inhibitor, clade B (ovalbumin), member Cancer and inflammation-associated ... Paladini RD, Takahashi K, Bravo NS, Coulombe PA: Onset of re-epithelialization after skin injury correlates with a reorganization of keratin filaments in wound edge keratinocytes: defining a...
- 17
- 283
- 0
Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Setup in Lusaka, Zambia
Ngày tải lên :
14/11/2016, 19:49
... Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Set-up in Lusaka, Zambia Abel H Irena‡¹, Mwate Mwambazi², Veronica Mulenga² ¹Valid International, ... Mortality of children with Severe Acute Malnutrition (SAM) in inpatient set-ups in sub-Saharan Africa still remains unacceptably high We investigated the prevalence and effect of diarrhea and HIV ... HIV/AIDS and diarrhea infections have been documented to substantially increase the mortality rate of children with SAM receiving treatment in inpatient units[8] The association of diarrhea and...
- 19
- 324
- 0
A NATIONWIDE SURVEY OF ENDOCRINE DISRUPTING CHEMICALS IN SOURCE AND DRINKING WATERS IN JAPAN
Ngày tải lên :
05/09/2013, 08:40
... treatment plants are conducting periodical monitoring of monitoring items included in Japanese water quality standard Sampling points were shown in Figure Analyzed Chemicals Target chemicals are selected, ... used for coating of water treatment facilities and distribution pipes (Kunikane, 1999), which indicates possibilities of contamination to occur during treatment Since ester phthalates are also frequently ... pesticide usage was also taken into consideration for sampling Analytical Methods In total, 12 analytical methods were employed in this study, mainly depending upon chemical properties of the target...
- 6
- 414
- 0
A discourse analysis of economic export contracts in english and vietnamese
Ngày tải lên :
26/11/2013, 13:26
... survey, nominalisation is used quite often in English business contracts Here is an example: Article 11: Default termination Terminate (v) —> Termination (n) (nominalisation) Nominalisation is also ... documents This type of language has a definite communicative aim accordingly has its own system of interrelated language The main aim of this type of communication is to state the conditions binding ... Party A- Party B (in a contract), legal status (a firm, an office, an agency), Individual (people), the debit- the account (in a financial report)… In Vietnamese, there is a range of official clichés...
- 101
- 797
- 4
A discourse analysis of collective labour agreements in english and vietnamese
Ngày tải lên :
26/11/2013, 13:30
... aware of the abilities of nominalization to create clarity and inclusiveness, ECAs drafters always pay attention to employ nominalization in their writing According to the survey, nominalization ... of rights and obligations in ECAs However, using these adjectives in generating rights and obligations is limited in ECAs, and not found in VCAs 4.3.2 Passive Voice Apart from passive verbs imposing ... What are the implications for teaching and learning of English language as well as writing legal documents, especially of them is extremely important In Vietnam, with the increasing establishment...
- 13
- 604
- 0
A discourse analysis of college admissions essays in english
Ngày tải lên :
26/11/2013, 13:31
... goals Through language, individuals establish and maintain social identity and relationships The study of language in use, Discourse analysis, has become a new area of language investigation since ... goods and services versus information 2.2.3.3 Thematisation Thematisation is concerned with the organization of information within individual clauses, and through this, with the organization of ... structure and lexico-grammatical features such as Transitivity, Mood and Thematisation - Synthesizing, discussing the findings and drawing 14 conclusions - Suggesting some implications for teaching and...
- 26
- 868
- 0
Tài liệu A Comparative Analysis of Individual Communication Processes in Small docx
Ngày tải lên :
09/12/2013, 16:15
... teaches business and organizational/management communication Her research interests focus primarily on the comparative analysis of organizational communication in multinational corporations; and ... cross-cultural communication in examining whether and how individuals communicate differently or similarly in intra- and cross-cultural situations Proceedings of the 2003 Association for Business Communication ... speaking time among the participants in group decision-making meetings A larger S.D indicates a larger degree of dispersion and thus a wider distribution of turns or speaking time It follows that...
- 16
- 521
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
Ngày tải lên :
07/03/2014, 06:20
... interaction of benzylamine analogues with bovine liver monoamine oxidase B Biochim Biophys Acta 1479, 52–58 Jones TZE, Balsa D, Unzeta M & Ramsay RR (2007) Variations in activity and inhibition with ... Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package (OriginLab Corp., Northampton, MA, USA), and ... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG...
- 9
- 327
- 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx
Ngày tải lên :
08/03/2014, 18:20
... Suhlanguage Text Processing - Application to Medical Narrative In [Kittredge 1084] [Grishman 10831 Grishman, R., Hirsehman, L and C Friedman Isolating Domain Dependencies in Natural Language Interfaces ... addition, it can be a repair action (alignment, repair), an assistance actions ( assistance ), and so on Only modifiers with appropriate semantic and syntactic category can be adjoined For example, ... omitted Nominalizations The increased frequency of prepositional modifiers in the equipment failure messages was traced to the frequent use of nominalizations in Navy messages Out of a preliminary...
- 4
- 515
- 0