a major public limitation

... hospital treatment, and increased risk of death from cardiovascular and respiratory diseases or lung cancer Particulate matter is estimated to cause about 8% of deaths from lung cancer, 5% of deaths ... cardiopulmonary-related deaths and non-allergic respiratory disease Some evidence supports an association of transportation-related air pollution with increased risks of lung cancer, myocardial ... Health Organization (WHO) air quality guidelines2,3,5,6 Particulate matter with a diameter of 2.5 µm or less (PM 2.5 ) 10 µg/m3 (annual mean) 25 µg/m3 (24 h mean) Particulate matter with a diameter...

Ngày tải lên: 23/03/2014, 02:20

... biomass smoke is a potential risk factor for lung cancer Nasopharyngeal and laryngeal cancer Biomass smoke has been implicated as a cause of nasopharyngeal carcinoma (100), although this is not a ... a las establecidas como referencia por la ´ Agencia para la Proteccion del Medio Ambiente de los ´ Estados Unidos La exposicion a esa contaminacion ´ ´ afecta principalmente a las mujeres y a ... sı´ntomas) ´ ´ y la enfermedad pulmonar obstructiva cronica ´ (evaluada clı´nicamente y mediante espirometrı a) , sobre todo entre las mujeres, algunas de las cuales acaban desarrollando enfisema o...

Ngày tải lên: 17/02/2014, 22:20

... in bacteria A probe for RNAase protection for mouse Cyp4x1 was obtained by PCR of brain RNA with primers 4x1-12-pF, 5¢-CATGGACATAAGTCCTTTTCCCTTCCTCCT-3¢, and 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG ... 5¢-AAACATAAATTTCGCCATTTCTCCTAG TAT-3¢ The full-length mouse cDNA was obtained with primers 4x1-f-pF, 5¢-ATGGAGGCCTCCTGGCTGGAG ACTCGTTGG-3¢ and 4x1-f-pR, 5¢-AAACATAAATTT CGCCATTTCTCCTAGTAT-3¢ Total RNA from mouse brain ... function Experimental procedures Animals and tissue Human cardiovascular system and 12-lane multitissue northern blots, human aorta cDNA library and RACE ready aorta cDNA were obtained from Clontech...

Ngày tải lên: 19/02/2014, 07:20

... MIR-D40 (Sanyo, Osaka, Japan) To amplify the DNA fragments containing a complete x-5 gliadin gene, oligonucleotides, 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, ... immunoassay for inhibition test Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... DNA was isolated from 0.1 g frozen leaves by the Isoplant DNA extraction Kit (Takara Bio Inc., Shiga, Japan) PCR was performed using KOD DNA polymerase (Toyobo, Osaka, Japan) and DNA AMPLIFIER...

Ngày tải lên: 20/02/2014, 01:20

... et al [25] and carries a mutation at locus STA1 encoding the small subunit of ADP-glucose pyrophosphorylase I7 accumulates less than 5% of normal starch quantity Standard media are fully detailed ... UK) ADPglucose was obtained from Sigma CL-2B SepharoseÒ column and PercollÒ were obtained from Amersham Pharmacia Biotech Starch assay kit was obtained from Roche (Germany) Chlamydomonas strains, ... activity measured in Chlamydomonas starch appeared 10- to 50-fold higher than that measured in vascular plant starches [24] We now report the cloning and characterization of cDNAs and gDNAs corresponding...

Ngày tải lên: 22/02/2014, 07:20

... APN3 AAX39865 Tni APN3 AAN75694 Har APN2 AAF37560 Hpu APN3 AAF99701 Epo AAD31183 Ldi APN1 AAC36148 Pin AAK58066 Hvi AAL83943 Bmo APN3 AAF37559 Hpu APN2 AAB70755 Pxy AAK69605 Sli AAF08254 Hvi AAX39866 ... Tni APN4 AAN75693 Har APN1 AAF37558 Hpu APN1 BAA33715 Bmo Family Family AAX39863 Tni APN1 AAC33301 Bmo Q11001 Mse CAA10950 Pxy P91885 Mse APN2 BAA32140 Bmo 0.1 AAD31184 Ldi APN2 A pisum APN CAA66467 ... substrate concentrations SEM values were calculated by fitting data by a weighted linear regression using the software SigmaPlotÒ AlabNA, L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide;...

Ngày tải lên: 16/03/2014, 12:20

... typical PPARa-target genes so far studied [3,13,21] Transcription of the peroxisomal hydratase-dehydrogenase (HD) and L-FABP genes is activated by PPARa within a few hours and the mRNAs reach ... transcriptional start site did not respond to a PPARa ligand Wy14 643 in the reporter gene assay (data not shown) Although an essential role of PPARa in the ligand-dependent transcriptional activation ... 17b-HSD-4 caused by the PPARa ligand in the liver as protein amount was not remarkable when compared with that of mRNA, and Corton et al suggested the possibility of post-translational regulation...

Ngày tải lên: 16/03/2014, 18:20

... proteins have been implicated in transcriptional activation and repression, regulation of alternative splicing, regulation of mRNA stability, translational activation or repression and RNA packaging ... A, Max KEA, Welfle H, Balbach J & Heinemann U (2004) Singlestranded DNA bound to bacterial cold-shock proteins: preliminary crystallographic and Raman analysis Acta Crystallogr D Biol Crystallogr ... bacteria are very similar and may be attributed to the same function, a finding that has already been demonstrated for the CSP paralogues of B subtilis and E coli [3,41] Apart from eubacteria, proteins...

Ngày tải lên: 23/03/2014, 09:21

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... Rica, Dominican Republic, Ecuador, El Salvador, Guatemala, Guyana, Haiti, Honduras, Jamaica, 1980-2005 Mexico, New Zealand, Nicaragua, Pakistan, Panama, Paraguay, Peru, South Africa, Trinidad and ... Norway, Bolivia, Ecuador, Mexico, Venezuela, Trinidad and Tobago, Bahrain, Iran, Kuwait, Oman, Qatar, Saudi Arabia, Syria, United Arab Emirates, Yemen, Brunei Dar-us-Salaam, Indonesia, Vietnam, Algeria, ... International Monetary Fund WP/10/245 IMF Working Paper Fiscal Affairs Department A Historical Public Debt Database Prepared by S Ali Abbas, Nazim Belhocine, Asmaa ElGanainy, and Mark Horton1 Authorized...

Ngày tải lên: 30/03/2014, 13:20

... membrane was probed with a rabbit antibody to rat liver glycogen synthase raised against residues IP KGKKKLHGEYKN(690–703) [25] or a goat antibody to GSK-3b (Santa Cruz, Santa Cruz, CA, USA) followed ... Results are expressed as means ± SEM for the number of hepatocyte preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and ... suggest that additional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be an important determinant of the subcellular compartmentation of glycogen...

Ngày tải lên: 31/03/2014, 01:20

... years Lab Science** years years years years Foreign Language years years years years Academic Electives years years years years * selected from algebra I, algebra II, geometry, trigonometry, analytic ... Essentially, that means you are 12 What Can You Do with a Major in Biology? choosing one primary area of study as well as a secondary specialty This will appear on your transcript when you graduate ... succeed as a biology major and, later on, as a professional Of course, practical knowledge of the fundamentals of biology and other technical areas, such as chemistry and math, is important, and...

Ngày tải lên: 01/06/2014, 10:54

... an exploratory data analysis technique to reveal natural grouping from latent patterns in a large data set on the basis of a minimal within-group and a maximal between-group variation, without ... control the false-positive error rate An alternative importance measure, which has the advantage of placing both types of variables on the same scale, is based on statistical significance values using ... Travassos C, Oliveira EXG, Viacava F: Geographic and social inequalities in the access to health Cienc Saude Coletiva 2006, 11:975-986 Narvai PC, Frazão P, Roncalli AG, Antunes JLF: Dental caries...

Ngày tải lên: 18/06/2014, 17:20

... In a series of multivariate analyses, each motivational factor was regressed against socio-demographic variables (gender, age), work related variables (years in service, managing people) and ... financial and non-financial incentives and motivating factors were appreciation by managers, colleagues and the community, a stable job and income and training A study from Mali based on a mixed-methods ... Socio-demographic data on age, gender, education, and work-related data such as years in service, department and managerial position were also collected Sample and data collection The present study was...

Ngày tải lên: 18/06/2014, 17:20

... bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from different but homologous gene segments present in a ... AY582061 PB2 B/Norway/1/84 AF101984 HA B/Memphis/5/93 AF129902 NA B/Memphis/3/93 AF129915 Putative Parents 3SEQ p-value Breakpoint Δ c-AIC B/Shiga/T30/98 B/Alaska/03/1992 B/Guangdong/05/94 B/Chile/3162/2002 ... were derived by plaque purification Furthermore, the same laboratory was the source for all four recombinants and the one putative parental strain As suggested in influenza A virus [9], further...

Ngày tải lên: 20/06/2014, 01:20

... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... data clearly show that farmers lack extensive knowledge about the insect pests and diseases and their natural enemies Weaver ant status and farmers’ opinion of them Most orchards had weaver ants, ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...

Ngày tải lên: 21/06/2014, 05:20

... South Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced February 2006 ... black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant species Ant baits (Amdro and Campaign ant bait) brought from Australia were tried ... that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant...

Ngày tải lên: 21/06/2014, 06:20

... least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... holders, having about of orchards with an average tree age ranging from years (from grafted materials) to 12 years (from seeds) Cashew apples were generally not used Cashew nut yield was about 1400...

Ngày tải lên: 21/06/2014, 06:20

... of Agricultural Science of South Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang ... theoretical and practical knowledge 2.6 *: = Very satisfactory; = Satisfactory; = Good; = unsatisfactory; = very unsatisfactory Course name: Natural enemies and their conservation Category* Average ranks ... and old trees c Treatment of early damaged parts on trees a For stem borers, scrape off all the damaged material on the tree trunk including larvae and pupae, and then use appropriate chemicals...

Ngày tải lên: 21/06/2014, 06:20

... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard, but we did not bait ... ghost ant baiting, weaver ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much...

Ngày tải lên: 21/06/2014, 06:20