a link between number theory and formal language theory

... findings and to illustrate additional ways in which degeneracy may facilitate robustness and evolvability in complex adaptive systems Our conceptual model comprises agents that are situated within an ... across a neutral network that reaches over truly unique regions of the fitness landscape Robustness and evolvability are not always compatible A positive correlation between robustness and evolvability ... Wagner asserts that, “understanding the relationship between robustness and evolvability is key to understand how living things can withstand mutations, while producing ample variation that leads...

Ngày tải lên: 13/08/2014, 16:20

... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...

Ngày tải lên: 18/02/2014, 06:20

... Australia is classi…ed as freely ‡ oating since December 1983 and as having a managed ‡ oat since 1974, and New Zealand is de…ned as having a managed ‡ oat since 1985 and a de facto moving band around ... can adopt any real value The value of is negative in a contractionary depreciation and positive in an expansionary depreciation All shocks are of the zero-mean, constant variance, type, and are ... (2005), Mohanty and Klau (2004) and Cavoli and Rajan (200 5a) , this e¤ect could be interpreted as an overall negative e¤ect of weaker real exchange rates on output in the aggregate demand schedule...

Ngày tải lên: 22/03/2014, 23:20

... as a Gaussian integer plus a complex number whose real and imaginary parts are each and - Show that this means that we can divide one between Gaussian integer a by another one /3 and obtain a ... applications of number theory have also broadened In addition to elementary and analytic number theory, increasing use has been made of algebraic number theory (primality testing with Gauss and Jacobi ... I la and (ii) if pal la, #lib arid a < 8,then palla f (b) Find a counterexample to the assertion that, if palla and pa)lb, then palla How many divisors does 945 have? List them all Let n be a...

Ngày tải lên: 31/03/2014, 16:20

... Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima ... death and, in particular, during apoptosis (for an overview see [15]) B Correlation between RA and certain human leukocyte antigen haplotypes (e.g HLA-DR4 [HLA-DRB1*0401 and HLA-DRB1*0404]) has ... 23 PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are associated with rheumatoid arthritis Nat Genet 2003, 34:395-402 Nakashima K, Hagiwara T, Yamada M: Nuclear localization...

Ngày tải lên: 09/08/2014, 01:23

... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggcccagcacgcttccgctgcgccactctgct ... A C t6 C A C A U tRNA B Provirus A- loop PBS HXB2WT 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGCGCCCGAACAGGGAC TTGAAAGCG … 3’ HXB2Met(e) 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGTGCCCCGTGTGAGGA TTGAAAGCG...

Ngày tải lên: 13/08/2014, 09:20

... which children learn and practice their language skills On one hand, parents serve as natural template and the main source of information for children's language acquisition Parents' ability to provide ... initial model 43 Figure Model fit and unstandardized parameter estimate for the hypothesized meditational model .46 Table Means and Standard Deviations for Demographic & Language ... association between language skills and behavior problems is also prevalent Standard measures of children's receptive vocabulary and verbal skills were associated with children's externalizing behaviors...

Ngày tải lên: 09/09/2015, 11:31

... Regular Language and Regular Grammar Chapter 4: Properties of Regular Language Chapter 5: Context-Free Grammar Chapter 7: Pushdown Automata Reading Materials • Giáo trình lý thuyết automat ngôn ... An introduction to formal languages and automata Peter Linz Introduction to automata theory, languages, and computation John Hopcroft & Jeffrey Ullman Assessment  Assignment: 30%  Final Exam: ...  Languages  Grammars  Automata Languages • Alphabet: a finite and nonempty set of symbols Σ = {a, b} • Example 1.1 • • Roman Alphabet: A, B,C, ,Z Greek Alphabet: α,β,… Language (cont’d) • String:...

Ngày tải lên: 13/05/2014, 10:21

... virus surface antigen mutants in Singapore patients with hepatocellular carcinoma and hepatitis B virus carriers negative for HBsAg but positive for anti-HBs and anti-HBc J Gastroenterol Hepatol 2002, ... Expression of viral microRNAs in Epstein-Barr virus-associated gastric carcinoma J Virol 2007, 81(2):1033-1036 Matsushita T, Okada T, Inaba T, Mizukami H, Ozawa K, Colosi P: The adenovirus E 1A and E1B19K ... and incubated for 24 h (panel C, D, E, respectively) and 48 h (panel F, G, H, respectively) before collected and applied to FACS assay Cells transfected with empty vector pcDNA3.1 (panel A) and...

Ngày tải lên: 18/06/2014, 18:20

... Visual Function Questionnaire had a somewhat larger percentage of Caucasian patients The change analysis sample was primarily male (64.1%) and Caucasian (81.9%), with a mean age of 59.3 years ... visual acuity was entered as a continuous variable rather than a fivelevel categorical variable Finally, as an exploratory descriptive analysis, change scores for each VFQ-25 item were calculated ... for age, gender, and baseline visual acuity In these models, the change group is a five-level independent variable Age and baseline visual acuity are continuous covariates, and gender is a categorical...

Ngày tải lên: 18/06/2014, 19:20

... virus surface antigen mutants in Singapore patients with hepatocellular carcinoma and hepatitis B virus carriers negative for HBsAg but positive for anti-HBs and anti-HBc J Gastroenterol Hepatol 2002, ... Expression of viral microRNAs in Epstein-Barr virus-associated gastric carcinoma J Virol 2007, 81(2):1033-1036 Matsushita T, Okada T, Inaba T, Mizukami H, Ozawa K, Colosi P: The adenovirus E 1A and E1B19K ... and incubated for 24 h (panel C, D, E, respectively) and 48 h (panel F, G, H, respectively) before collected and applied to FACS assay Cells transfected with empty vector pcDNA3.1 (panel A) and...

Ngày tải lên: 20/06/2014, 01:20

... Visual Function Questionnaire had a somewhat larger percentage of Caucasian patients The change analysis sample was primarily male (64.1%) and Caucasian (81.9%), with a mean age of 59.3 years ... visual acuity was entered as a continuous variable rather than a fivelevel categorical variable Finally, as an exploratory descriptive analysis, change scores for each VFQ-25 item were calculated ... for age, gender, and baseline visual acuity In these models, the change group is a five-level independent variable Age and baseline visual acuity are continuous covariates, and gender is a categorical...

Ngày tải lên: 20/06/2014, 16:20

... two-dimensional pdf are nearly parallel, and so it is as if we are calculating the marginal pdf of the two-dimensional spatial pdf along the x-axis Since the marginal pdf of a two-dimensional Gaussian ... multipath angle of arrival (AoA) at the BS has been derived for the general case of an arbitrary angle spread It is shown that this pdf can be approximated by a Gaussian curve for sources with a ... Liberti and T S Rappaport, Smart Antennas for Wireless Communications: IS-95 and Third Generation CDMA Applications, Prentice Hall, Upper Saddle River, NJ, USA, 1999 [2] J B Andersen, “Antenna arrays...

Ngày tải lên: 23/06/2014, 01:20

... {λ}) 12 Languages  Language: a subset L of Σ*  Word or Sentence: a string in L 13 Languages  Example 1: Σ = {a, b} * Σ = {λ, a, b, aa, ab, ba, aaa, } L1 = {a, aa, aab} (finite language) n n ... thúc học phần Formal Languages & Automata A formal language:  Is an abstraction of the general characteristics of programming languages  Consists of a set of symbols and some formation rules ... output, may have some temporary storage, and can make decisions in transforming the input into the output Formal Languages & Automata Some immediate and important applications  Digital design...

Ngày tải lên: 11/07/2014, 19:20

... Regular Language and Regular Grammar Chapter 4: Properties of Regular Language Chapter 5: Context-Free Grammar Chapter 7: Pushdown Automata Reading Materials • Giáo trình lý thuyết automat ngôn ... An introduction to formal languages and automata Peter Linz Introduction to automata theory, languages, and computation John Hopcroft & Jeffrey Ullman Assessment  Assignment: 30%  Final Exam: ...  Languages  Grammars  Automata Languages • Alphabet: a finite and nonempty set of symbols Σ = {a, b} • Example 1.1 • • Roman Alphabet: A, B,C, ,Z Greek Alphabet: α,β,… Language (cont’d) • String:...

Ngày tải lên: 14/07/2014, 02:20

... L(r1) Example 3.2 L (a* (a + b)) = L (a* ) L (a + b) = (L (a) )* (L (a) ∪L(b)) = {λ, a, aa, aaa, }. {a, b} = {a, aa, aaa, , b, ab, aab, } Example 3.3 r = (a + b)* (a + bb) L(r) = ? Example 3.3 r = (a + b)* ... Regular Expression and Regular Language • Regular Expression vs Regular Language • Regular Grammar Regular Expression Alphabet Σ ∅, λ, a Σ are regular expressions (known as primitive regular expressions) ... {S → a A → aB | λ B → Ab} G is a linear grammar but not regular Theorem 3.1 If G is a right-linear grammar, then L(G) is a regular language Proof: There exists an NFA M that accepts L(G) M accepts...

Ngày tải lên: 14/07/2014, 02:20

... homomorphic image is defined as: h(L) = {h(w): w ∈ L} Example 4.3 Σ = {a, b} Γ = {a, b, c} h (a) = ab h(b) = bbc h(aba) = abbbcab L = {aa, aba} ⇒ h(L) = {abab, abbbcab} Homomorphism (cont’d) If r is a regular ... L(M1) ∩ L2 = {a} b b q3 a, b L(M2) ∩ L2 = {a} L(M3) ∩ L2 = ∅ Standard representation  Standard representation of a regular language is one of the followings: – – – Finite automaton Regular expression ... Σ, δ, q , F^) accepts L /L If y ∈ L and δ*(q , y) ∈ F ⇒ add q to F^ i i Example 4.6 L = L (a* baa*) L = L(ab*) L /L = ? Example 4.6 (cont’d) L1 = L (a* baa*) L1 = L(ab*) a q0 a b q1 a q2 L(M0) ∩...

Ngày tải lên: 14/07/2014, 02:20

... aS | A S → aS | A A a A a A a B → aa B → aa C → aCb 10 Example 6.5 G = ({S, A, B, C}, {a, b}, S, P) S → aS | A | C S → aS | A S → aS | A A a A a A a B → aa B → aa C → aCb dependency graph S A B ... (i =1, n) ∈ P^ Example 6.2 G = ( {A, B}, {a, b}, A, P) A → Aa | aBc | λ B → Bb | ba A → aBc | aBcZ | Z | λ A → aBc | aBcZ | Z | λ Z → a | aZ Z → a | aZ B → Bb | ba B → ba | baY Y → b | bY Removing ... if all xi are nullable, then A → λ is not put into P^ 19 Example 6.5 (cont’d) S → ABaC S → ABaC | BaC | AaC | ABa | aC | Aa |Ba | a A → BC A → B | C | BC B→b|λ B→b C→D|λ C→D D→d D→d VN = {A, ...

Ngày tải lên: 14/07/2014, 02:20

... Grammars for NPDA δ(q , a, A) = {(q , BC), } i j ? At q erase A and move to q if receiving a and i k at q erase BC and move to q j k At q erase A and move to q if receiving a and i k at q erase ... erase B and move to q and j m at q m erase C and move to q k 22 Context-Free Grammars for NPDA δ(q , a, A) = {(q , BC), } i j At q erase A and move to q if receiving a and i k at q erase B and move ... Pushdown Automata • There are context-free languages that are not regular • Finite automata cannot recognize all context-free languages Example 7.1 • {a, b}* is regular • {akbk | k is a constant}...

Ngày tải lên: 14/07/2014, 02:20

... Can and B.E Sagan, Partitions, rooks, and symmetric functions in noncommuting variables, arXiv:math.CO/1008.2950 [5] M.H Rosas and B.E Sagan, Symmetric functions in noncommuting variables, Trans ... of Science and Technology, and the National Science Foundation of China References [1] N Bergeron, C Hohlweg, M.H Rosas and M Zabrocki, Grothendieck bialgebras, partition lattices, and symmetric ... noncommutative variables, Electron J Combin 13, (2006), #R75 [2] N Bergeron, C Reutenauer, M.H Rosas and M Zabrocki, Invariants and coinvariants of the symmetric group in noncommuting variables, Canad...

Ngày tải lên: 08/08/2014, 12:23