a library for our raspberry pi and arduino shield

... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... scans at a resolution of cm)1 The spectra were baseline corrected and normalized for equal area between 1711 and 1485 cm)1 Spectra were encoded every cm)1 Data analysis All spectra were treated ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers...

Ngày tải lên: 21/02/2014, 03:20

... evokes and define a set of concepts associated with that color For Task 2, we showed a particular facial feature and a swatch in a particular color, and asked 50 workers to name the color and describe ... represents danger in Malaysia, envy in Belgium, love and happiness in Japan; red is associated with luck in China and Denmark, but with bad luck in Nigeria and Germany and reflects ambition and desire ... terms and collocations that represent various hues, darkness, saturation and other natural language collocations We also perform a comprehensive analysis of the data by investigating several questions...

Ngày tải lên: 22/02/2014, 02:20

... (fulani,swahili) (greek,serbian), (greek,maya) (hebrew,zapotec), (japanese,turkish) (japanese,kannada), (kannada,turkish) (malay,yoruba), (maya,serbian) The contrasts (uniquely) were made with a ... re-discovered some classical analyses (of the Amerindian language Seneca by Lounsbury), has successfully analyzed previously unanalyzed languages (e.g., Bulgarian), and has improved on previous analyses of ... Two classes C1 and C2 are contrasted by a Boolean or nominal feature if the instances of C1 and the instances of C2 not share a value • Two classes C1 and C2 are contrasted by a numeric feature...

Ngày tải lên: 08/03/2014, 06:20

... requires that theater and global distribution, maintenance, and supply operations be rapidly configured and expanded and that global prioritization and allocation of combat support resources be rapidly ... Clarke, AMC /A5 , and her staff, particularly Mr Ed Acosta, AMC /A5 , and Mr Dave Merrill, AMC /A5 9 We also thank Lt Col Bob Eubanks, AMC /A3 1, Mr Mo Verling, AMC /A3 8IP, Mr Gary Little, AMC /A3 8B, and Mr ... communications and information systems also could be helpful Based on our analysis, using an expanded resource allocation STT framework to separate supply, demand, and integrator processes and assigning...

Ngày tải lên: 15/03/2014, 16:20

... Lafferty, Andrew Mccallum, and Fernando Pereira 2001 John lafferty and andrew mccallum and fernando pereira In Proceedings of the International Conference on Machine Learning, Williamstown, MA, ... the same features The implementation is in Java, and we interface with the Hadoop cluster via the native Java API It can be easily adapted to a wide range of NLP tasks Incorporating new features ... 2002 Conference on Empirical Methods in Natural Language Processing, Philadelphia, PA, USA Jeffrey Dean and Sanjay Ghemawat 2004 Mapreduce: simplified data processing on large clusters In Proceedings...

Ngày tải lên: 17/03/2014, 22:20

Ngày tải lên: 23/03/2014, 05:23

... [11]; and quality assurance and accreditation mechanisms for public health departments and related agencies [12-14] One response to this growing demand for a trained, competent workforce has been ... potential leader in establishing a thriving research base that emphasized population health and health behaviour research while generating responsive and progressive health and human service training ... number not for citation purposes) Human Resources for Health 2009, 7:71 graduate and undergraduate public health degree programmes, CEPH accreditation and plans for a school of public health Case description...

Ngày tải lên: 18/06/2014, 17:20

... disciplined approach,” IEEE Design and Test of Computers, vol 19, no 6, pp 6–16, 2002 [24] S Mohanty and V K Prasanna, “Rapid system-level performance evaluation and optimization for application mapping ... provide additional information for YML objects Certain simulators may require certain information on parameter values For example, Sesame ’s architecture simulator needs to read an array of execution ... layer, architecture model layer, and the mapping layer which is an interface between application and architecture models THE SESAME APPROACH The Sesame modeling and simulation environment facilitates...

Ngày tải lên: 22/06/2014, 19:20

... gaging practice and tolerances of ANSI B1.20.1 For standard-weight pipe NPS [DN 150] and smaller, refer to Table X3.1 for threading data For standardweight pipe NPS [DN 200] and larger and all ... couplings for standard-weight pipe and taper-tapped couplings for extra-strong and double extrastrong pipe If taper-tapped couplings are required for pipe NPS [DN 50] and smaller on standard-weight pipe, ... COPYRIGHT American Society of Mechanical Engineers Licensed by Information Handling Services Workmanship, Finish and Appearance PART A — FERROUS MATERIAL SPECIFICATIONS of the dent and a prolongation...

Ngày tải lên: 10/07/2014, 23:20

... using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense ... (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG (sense) and GGTCCACCACCCTGTTGCTGTAGCC (antisense) as primers Reverse transcription PCR was carried out using an ... IκB/nuclear factor-κB (NFκB) pathway (i.e PSI; dashed line) and the NF-κB/activator protein (AP)-1 pathway SN50, it was established that the NF-κB and AP-1 pathway is relevant to Cyp7b activity All...

Ngày tải lên: 09/08/2014, 07:20

... correlation coefficient Figure The heart rates of reindeer calves in relation to different behaviour categories Data for each behaviour category has been calculated as an average of individual mean ... Polar Electro Oy, Kempele, Finland) and its applicability in behavioural studies We also describe the daily rhythms of HR in unrestrained captive reindeer calves Materials and methods Animals and ... heart rate for activities of white-tailed deer J Wildl Manage 1980, 44, 333-342 Mesteig K, Tyler NJC, Blix AS: Seasonal changes in heart rate and food intake in reindeer (Rangifer tarandus tarandus)...

Ngày tải lên: 12/08/2014, 15:20

... Summary MS-Access is a powerful relational database program It has many integrated features and can be greatly customized to fit most personal/departmental needs for data collection and storage ... II type grants) PA Harris, Vanderbilt University What is in an MS-Access file - 1? Although the term “database” typically refers to a collection of related data tables, an Access database includes ... available (packaged with MS-Office Premium) Easy to use (relative to other systems –Oracle may require one FTE to maintain the server as a database administrator and another FTE to serve as an...

Ngày tải lên: 24/10/2014, 15:10

... Research Journal Journal of Agricultural and Food Chemistry Journal of the Association of Official Analytical Chemists Journal of Animal Science Journal of the American Dietetic Association Journal ... Murano Automation for Food Engineering: Food Quality Quantization and Process Control Yanbo Huang, A Dale Whittaker, and Ronald E Lacey The Food Chemistr y Laboratory A Manual for Experimental ... difference among treatment means is large (greater than standard deviations), it is not necessary to conduct a statistical analysis If the data not meet these criteria, appropriate statistical analysis...

Ngày tải lên: 21/04/2015, 13:38

... need for reshaping at network boundaries However, the underlying factors and to what extent these factors can cause conformance deterioration are still not clear without analytical analysis In addition, ... denition, for any time t and some s { }, A (t + d ) A (t + d s) + (s) max max Combining (2.18) and (2.19), A (t) > A (t + d s) + (s) max and hence (s) < A (t) A (t + d s) max = A (t) A (t ... stochastic QoS performance In 1.2 Stochastic QoS addition, it is shown that a server serving an aggregate of ows can be regarded as a stochastic server for individual ows within the aggregate...

Ngày tải lên: 11/09/2015, 21:20

... Library and Peking University Library I want to thank my graduate classmates Fan Xue, Fan Rui, Ji Xing, Wang Yue and Ma Jilian, for providing a stimulating and fun environment in which to learn and ... and melodrama ambiguously The study of returenee filmmakers provides an opportunity to break through the boundaries of geography (the Great Rear Area/Shanghai) and producers (filmmakers/drama ... Dr Nicolai Volland for his continuous support of my Master study and research, for reading my proposals, making comments and revising my thesis drafts, with his patience, motivation and immense...

Ngày tải lên: 26/09/2015, 09:47

... table As you know, AND truth table is AND TRUTH TABLE A B Output 0 0 1 1 0 Fig: A 2-2-1 Neural Network and Truth Table Of AND In the above network, N1 and N2 are neurons in input layer, N3 and ... BrainNet library Understanding Neural Networks One fascinating thing about artificial neural networks is that, they are mainly inspired by the human brain This doesn't mean that Artificial Neural Networks ... flattened so that even a beginner can understand it Suggestions and modifications are always welcome Send your modifications, hacks and suggestions to amazedsaint@gmail.com Q) Whether this library...

Ngày tải lên: 28/04/2014, 10:10

Ngày tải lên: 28/08/2014, 15:58

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... bitter and more intense in currant flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was...

Ngày tải lên: 03/04/2013, 21:06

... Ramos et al are available for the first case and guide vane closure of a turbine, and they were obtained in lab conditions and compared with a reliable one-dimensional calculation Ramos et al ... Figure compares the results of Suter parameters [6] and Derakhshan [5] with one experimental performance curve for a real PAT operating as a pump and turbine mode The variation of head, power and efficiency ... and ω the rotational speed Suter parameters give information for both the turbine and the pump mode for few available pumps, and the Derakhshan model predicts information for the turbine performance...

Ngày tải lên: 05/09/2013, 14:58

... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance, every ... to act The same rule applies to a representative who has exceeded his powers Article The drawer guarantees both acceptance and payment 33 34 He may release himself from guaranteeing acceptanceevery...

Ngày tải lên: 22/10/2013, 10:15