a level by level analysis of the crisis

... to the extraposition cases, I will recast it in terms of a closely related automaton, the Bottom-up EPDA (BEPDA) ~ The BEPDA consists of a finite-state control and of a stack of stacks There are ... of moves: either an input is read and pushed onto a new stack on top of the stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and ... than an EPDA has two advantages: first, the data-driven bottom-up automaton represents a more intuitive model of human sentence processing than the top-down automaton; second, the grammar that...

Ngày tải lên: 23/03/2014, 20:20

... and meta -analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... fibromyalgia when comparing primary care and specialised care Our meta -analysis demonstrates that there are no differences in the overall outcome of fibromyalgia regardless of the level of care ... Garcia-Campayo et al Table Characteristics of the 33 selected randomised controlled trials and the patients studied in them Treatment Level of care % of women Mean age Length of treatment (years)...

Ngày tải lên: 09/08/2014, 10:23

... formed by two antecedents attitude toward act or behaviour (AACT) and subjective norm (SN) AACT represents the evaluation of the advantages and disadvantages associated with the performance of a given ... populations Innovation can be studied at four distinct levels: the individual healthcare professionals; the healthcare professionals groups; the healthcare organisations; and the larger healthcare ... that are used to assess the reliability of individual data aggregated at group level in hierarchical models, such as the intra-class correlation (ICC1 and ICC2), the eta-squared (η2), and the...

Ngày tải lên: 10/08/2014, 10:22

... out data management, analysis of the data including multilevel modeling, interpretation of data, and created the first draft of the manuscript EN was involved with the management of data, participated ... using parallel statistical methods, and the two years' data were treated as replicate studies Multilevel analysis was chosen to account for the hierarchical nature of the data (lifeguards nested ... participated in the analysis and interpretation of data, and provided revisions on the content of the manuscript TE coordinated the original data collection and was involved with the data management...

Ngày tải lên: 10/08/2014, 10:22

... 17 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A DATA ANALYSIS AND DISCUSSION 3.1 Analysis of data 3.1.1 Lexical choice By referring ... indicates the evaluation of the speaker toward the truth or probability of a representation of reality From that base, we have an account of the two types of modality in the speech and times of their ... developed and it lies in the remainder of the clause Normally, the choice of Theme reveals the meaning of the clause, more particularly the thematic meaning that clause conveys Theme/Rheme has relations...

Ngày tải lên: 18/12/2013, 10:08

... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... For the significance of the RNA binding data, a Levene statistical was used for acceptance of variance equality One-way ANOVA and Bonferroni analyses were used to evaluate the data to a 95% level...

Ngày tải lên: 16/03/2014, 03:20

... (1974)  As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder  As the cylinder spacing increases, the wave force on the cylinders ... not decrease linear to the wave force on an isolated cylinder, however it oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio  ... to the interaction of the cylinders, the run-up profiles of the cylinders are quite different from that of an isolated cylinder  This numerical computation method will be used broadly for analysis...

Ngày tải lên: 26/07/2014, 07:20

... language, a language of education, a working language, a lingua franca, (a language for) the expression of national identity and an international language” (p.74) The paramount concern of the government ... 2002:281) In the Singaporean context, the government’s emphasis on the mastery of the standard variety of English as a means towards maximising competitive advantage is clearly a case of language commodification ... comprehensive than the diglossia framework because it examines variation both along a cline of proficiency as well as of formality An even more recent approach to the analysis of Singapore English is the...

Ngày tải lên: 16/10/2015, 15:35

... Aid Program commonly known as The Marshall Plan General Marshall was awarded the Nobel Peace Prize in 1953 for his role as architect and advocate of the Marshall Plan A text analysis of The 2014 ... to react in a particular way after having heard the text The usage of particular (and appealing) texts is essential in discourses where verbal means are the only way of influencing the addressees‘ ... approach, and in the meantime, make the smartest application of the technology that you already have […] The AIDS epidemic offers an example The broad goal, of course, is to end the disease The highest-leverage...

Ngày tải lên: 25/06/2016, 20:56

... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the ... “yes”, the survey was discarded assuming the participant did not fully understand the question Statistical analysis The data was analyzed using both parametric and non parametric statistics and the ... pathways, the “voluntary path” and the “involuntary path” otherwise known as the “emotionally-driven path” (5) The voluntary pathway begins from the premotor opercular areas and travels via the...

Ngày tải lên: 26/10/2012, 09:57

... Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities in Nhan Dan Table ... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...

Ngày tải lên: 07/11/2012, 14:39

... from the Voice of America and Nhan Dan These two sources are chosen as the database for the analysis as they are both popular and reliable sources of information 2.1.1.1 Voice Of America The Voice ... the rationale, the scope of the research, the aims of the research, the methodology and the design of the research - Part 2- Development: This is the main part of the thesis and has three chapters ... particularly associated with Michael Halliday (Halliday 1978, 1994), is an approach to language that views language in its social context, as an instrument of social interaction, rather than a...

Ngày tải lên: 07/11/2012, 14:39

... processes are attributed to the US and Japan (76.9%) and all these processes are either verbal (60%) or material (40%) The US and Japan play the role of actor and sayer in all the processes In material ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan The analysis of lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s ... participants By using neutral and formal names to refer to both North Korea and the US- Japan coalition, Nhan Dan treated them equally and viewed them as having equal right and power The analysis of lexicalization...

Ngày tải lên: 07/11/2012, 14:39

... II APPENDIX Headlines from Nhan Dan ND1* Triều Tiên thử tên l a, Mỹ Nhật Bản đe d a trừng phạt 05/07/2006 ND2* Trung Quốc quan tâm, Nhật Bản tiếp tục đàm phán vấn đề tên l a Triều Tiên ... Trung Quốc Nga đ a dự thảo nghị vấn đề tên l a Triều Tiên 13/07/2006 ND10 Các nước thường trực HĐBA LHQ họp vấn đề tên l a Bình Nhưỡng 14/07/2006 ND11* LHQ thông qua nghị vấn đề tên l a Triều Tiên ... trừng phạt thêm Mỹ Triều Tiên 21/07/2006 Note : The news reports marked with (*) are sampled for full-text analysis III ...

Ngày tải lên: 07/11/2012, 14:39

Ngày tải lên: 07/11/2012, 14:39

... of America and Nhan Dan Aims of the research To provide a textual analysis To give an illustration of CDA concepts and analysis procedures To convey a message Research questions What are the ... VOA  Formal and neutral names for the US and Japan  Negative names for NK  Nhan Dan formal and neutral names for both groups of participants lexicalization  VOA  Negativization of NK’s activities ... the roles ? Analyzing full-text news reports Naming referents Lexicalization Over-lexicalization Quotation patterns Data analysis and discussion Analysis of headlines Analysis of full-text...

Ngày tải lên: 07/11/2012, 14:39

... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the ... with other verbs to create verb phrases in the sentence 1.4 Contrastive analysis (CA) As one of the main aims of this paper is to carry out a contrastive analysis on the meanings expressed via the...

Ngày tải lên: 29/01/2014, 00:23