a key protein in translesion synthesis in human cells

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... fw, forward; rev, reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

... examined The inset of Fig illustrates obtained titration plots It clearly indicates that the Syn HO-1 protein (10 lM) is saturated at a ratio of : hemin to protein, thereby establishing that ... Kishida, Y., Kohora, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M & Tabata, S (2001) Complete genomic sequence of the filamentous ... [35] and have succeeded in obtaining highly purified soluble protein, Syn HO-1, in a large scale This is the first report of the characterization of the isolated cyanobacterial HO-1 protein and...

Ngày tải lên: 23/03/2014, 20:22

12 459 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... increasing hydrogen ion concentration, involving a proton-catalysis by the distal (a5 8) histidine with pKa ˆ 6.2, as with the separated chains The value of ks also increased with increasing hydrogen ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against ... evidence suggests that the a1 b1 interface is much more important in maintaining normal hemoglobin stability than is the a1 b2 interface As a matter of fact, hemolytic anemia is known to result...

Ngày tải lên: 31/03/2014, 15:20

10 648 0
Báo cáo y học: "Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells" potx

Báo cáo y học: "Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells" potx

... dehydrated and mounted in XAM (BDH, Poole, UK) Image analysis All slides were visualised using Leica RMDB research microscope and images captured using a digital camera and Bioquant Nova image analysis ... to and to 12 Data was then presented as means ± standard errors Statistical analysis Data was non-parametric and thus Kruskal Wallis with all pairwise comparisons post hoc test Conover-Inman was ... means and standard errors calculated In addition DNA content per bead was calculated as an indication of cell proliferation Available online http://arthritis-research.com/content/11/5/R137 RNA...

Ngày tải lên: 09/08/2014, 14:22

10 437 0
Identification and characterization of iron homeostasis  related genes and HCC down regulated mitochondrial carrier protein (HDMCP), a novel liver specific uncoupling protein in human hepatocellular carcinoma (HCC

Identification and characterization of iron homeostasis related genes and HCC down regulated mitochondrial carrier protein (HDMCP), a novel liver specific uncoupling protein in human hepatocellular carcinoma (HCC

... 5’-RACE β2m mitochondrial membrane potential 5'-rapid amplification of cDNA ends β2-microglobulin aa AAH AFP ALAS ANOVA ATP amino acid atypical adenomatous hyperplasia α-fetoprotein δ-aminolevulinate ... efficacy of therapy The most commonly elevated blood tests with liver damage are aspartate aminotransferase (AST) and alanine aminotransferase (ALT), gamma-glutamyl transpeptidase (GGT) and alkaline ... that more than one fifth of the total transcripts in normal liver encodes plasma proteins (2) Transcripts encoding plasma proteins including albumin, apolipoproteins, alpha-1-antitrypsin, anti-thrombin...

Ngày tải lên: 16/09/2015, 15:55

184 496 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

... Carlsbad, CA, USA) and anti-T7 Tag monoclonal antibody (Novagen, San Diego, CA, USA) A pcDNA/Amp eukaryotic expression vector and LipofectAMINE Reagent were purchased from Invitrogen (Carlsbad, CA) pGEM-T ... (2000) Integrin alpha(1)beta(1)-mediated activation of cyclin-dependent kinase activity is involved in neurite outgrowth and human neurofilament protein H Lys-Ser-Pro tail domain phosphorylation ... M., Murayama, M., Noguchi, K., Ishiguro, K., Imahori, K & Takashima, A (1998) Characterization of tau phosphorylation in glycogen synthase kinase- 3beta and cyclin dependent kinase-5 activator...

Ngày tải lên: 23/03/2014, 21:21

8 329 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... plate was read on a Labsystems Multiskan plate reader using the absorbance difference, A4 50 )A5 40 Detection of human TNF -a mRNA by NASBATM TNF -a mRNA levels were measured by NASBATM (nucleic acid ... (1999) Basic Principles and Clinical Correlates In Inflammation (Gallin, J.I & Snyderman, R., eds), pp 471–486 Lippincott Williams & Wilkins, Philadelphia Watanabe, N., Nakada, K & Kobayashi, Y (1998) ... level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There was a background level...

Ngày tải lên: 31/03/2014, 01:20

7 322 0
Dịch key texts in human geography

Dịch key texts in human geography

... Explanation in Geography by David Harvey’, The Geographical Journal 136: 303 Haggett, P (1965) Locational Analysis in Human Geography London: Edward Arnold Harvey, D (1963) Explanation in Geography Arnold: ... ‘Comment in reply’, Annals of the Association of American Geographers 63 (4): 568–569 Schaefer, F (1953) ‘Exceptionalism in geography: a methodological examination’, Annals of the Association of American ... Geography London: Sage, 237–250 Gale, S (1971) ‘On the heterodoxy of explanation: a review of David Harvey’s Explanation in Geography’, Geographical Analysis 3: 285–322 - 37 - KEY TEXTS IN HUMAN...

Ngày tải lên: 26/04/2014, 09:16

226 4,5K 11
Key texts in human geography

Key texts in human geography

... as an early intervention in geography’s attempt to restyle itself as a spatial science, and remains an obligatory point of passage for many geographers working on spatial data analysis, GIS and ... saw the emergence of a range of software packages for handling spatial data Spatial analysis as practised with GIS deals with geometrical operations on spatial data On both sides of the Atlantic ... six arguments for a spatial approach in the social sciences (and note that all six apply to both space and time): • Integration A spatial approach allows information to be placed in context, and...

Ngày tải lên: 27/04/2014, 22:06

257 2,5K 0
Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc

Báo cáo hóa học: " Subcellular forms and biochemical events triggered in human cells by HCV polyprotein expression from a viral vector" doc

... for analysis Total RNA (1.5 μg) was amplified with an Amino Allyl MessageAmp aRNA kit (Ambion); 54 to 88 μg of amplified RNA (aRNA) was obtained The mean RNA size was 1,500 nucleotides, as observed ... human liver tissues and cells Cancer Res 2003, 63:5041-5045 Tsunedomi R, Iizuka N, Hamamoto Y, Uchimura S, Miyamoto T, Tamesa T, Okada T, Takemoto N, Takashima M, Sakamoto K, Hamada K, Yamada-Okabe ... (see induced apoptosis in a caspase-dependent manner HCV proteins previous page) HCV proteins induced apoptosis in a caspase-dependent manner A: Extent of apoptosis HeLa cells were infected at...

Ngày tải lên: 20/06/2014, 01:20

20 622 0
Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

... definitely not lead to an increase in this proportion NATURAL VARIABILITY The natural variability has to be established as a basis for judging whether or not new trees are better than existing ... experiments in the laboratory, in a pilot plant and in mills Many properties of wood and fibers are being measured at several levels of detail The arsenal of measurement techniques available today for ... hemisphere A widespread species of this family is Populus tremula, also called aspen Aspen is also a very good raw material for printing papers and an increase in the production of aspen pulpwood...

Ngày tải lên: 08/08/2014, 14:20

12 229 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

... 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ activated at 95°C for 10 minutes followed by 45 cycles of denaturing at ... according to a previously published and validated grading system where = no staining, = weak staining, = moderate staining, = strong staining, = very intense staining [6,13,17] Histopathology Pathological ... staining was seen in the crypts of rats that had received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after 22.5 Gy and 30 Gy as indicated...

Ngày tải lên: 09/08/2014, 08:22

8 335 0
Damaged DNA-binding protein 2 (DDB2) protects against UV irradiation in human cells and Drosophila ppt

Damaged DNA-binding protein 2 (DDB2) protects against UV irradiation in human cells and Drosophila ppt

... that DDB2-mediated DNA repair may be required in UV resistance In addition, UV irradiation may activate a cFLIP-regulated apoptotic pathway in certain cells Methods Cell lines and culture Human ... cleavage and activation of caspases-8, 9, and in both control HeLa and HR3 cells, the cleavage/activation was considerably reduced in HR3 cells (Fig 2A) Similarly, cleavage of both PARP and DNA ... Yin D-T, Zhao Q, Wani G, Arafa ESA, El-Mahdy MA, Wani AA: Overexpression of DDB2 enhances the sensitivity of human ovarian cancer cells to cisplatin by augmenting cellular apoptosis Int J Cancer...

Ngày tải lên: 10/08/2014, 05:21

14 142 0
Báo cáo y học: "Recent key advances in human immunodeficiency virus medicine and implications for Chin" potx

Báo cáo y học: "Recent key advances in human immunodeficiency virus medicine and implications for Chin" potx

... Vaccine Results from the phase-3 Thai vaccine trial using a combination of ALVAC, a recombinant canarypox vector vaccine, and AIDSVAX, a recombinant glycoprotein-120 subunit vaccine, were released ... W: Is abacavir (ABC)containing combination antiretroviral therapy (CART) associated with myocardial infarction (MI)? No association identified in pooled summary of 54 clinical trials [abstract] ... China, 4National Institute of Allergy and Infectious Diseases, National Institutes of Health, based at the U.S Embassy Beijing, No 55 An Jia Lou Lu, Beijing 100600, PR China and 5China Medical...

Ngày tải lên: 10/08/2014, 05:21

8 352 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism Plant Cell 2006,...

Ngày tải lên: 11/08/2014, 11:21

10 427 0
Báo cáo y học: "Lactate: a key metabolite in the intercellular metabolic interplay" pptx

Báo cáo y học: "Lactate: a key metabolite in the intercellular metabolic interplay" pptx

... lactate was maintained at a higher but constant value, indicating that the liver is not mandatory for lactate clearance [20] Lactate also appears to possess some specific effects besides its role in ... new and fascinating side of brain lactate metabolism [24,25] Concerning heart metabolism and cardiovascular function, it has recently been shown that lactate improves cardiac function in a model ... organ is able to release lactate because all cells contain the different enzymes allowing the conversion of glucose into lactate; pancreatic islets are an exception since they are deficient in...

Ngày tải lên: 12/08/2014, 18:21

3 251 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

... than in control animals treated with an antiviral alone [10] Human data on the effect of corticosteroids in viral pneumonia are limited, but in a retrospective study of patients with severe varicella ... regarding the use of steroids in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration ... therapy Steroid therapy causes significant adverse effects, and this remains true in patients with SARS Wang and coworkers [12] described a case of fatal aspergillosis, and recent press reports indicate...

Ngày tải lên: 12/08/2014, 20:20

3 355 0
Báo cáo y học: " The HBZ gene, a key player in HTLV-1 pathogenesis" doc

Báo cáo y học: " The HBZ gene, a key player in HTLV-1 pathogenesis" doc

... 3:15 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, et al.: A novel alternative splicing isoform of human T-cell leukemia virus ... USA 1981, 78:6476-6480 Takeda S, Maeda M, Morikawa S, Taniguchi Y, Yasunaga J, Nosaka K, Tanaka Y, Matsuoka M: Genetic and epigenetic inactivation of tax gene in adult T-cell leukemia cells Int ... Koiwa T, Hamano-Usami A, Ishida T, Okayama A, Yamaguchi K, Kamihira S, Watanabe T: 5'-long terminal repeat-selective CpG methylation of latent human T-cell leukemia virus type provirus in vitro and...

Ngày tải lên: 12/08/2014, 23:21

8 585 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, ... out-of-hospital cardiac arrest JAMA 2005, 293:299-304 Abella BS, Alvarado JP, Myklebust H, Edelson DP, Barry A, O'Hearn N, Vanden Hoek TL, Becker LB: Quality of cardiopulmonary resuscitation after in- hospital ... of the greatest advances in critical care medicine during the past decade Similarly, recent technology has also enhanced the quality of basic CPR For the past four decades, basic CPR has been performed...

Ngày tải lên: 12/08/2014, 23:21

3 281 0
Báo cáo y học: "A novel envelope mediated post entry restriction of murine leukaemia virus in human cells is Ref1/ TRIM5a independen" potx

Báo cáo y học: "A novel envelope mediated post entry restriction of murine leukaemia virus in human cells is Ref1/ TRIM5a independen" potx

... (5’-CAACAGCCACAACGTCTATATCAT-3’), 400 nM reverse primer (5’-ATGTTGTGGCGGATCTTGAAG-3’), 100 nM probe (5’-6carboxyfluorescein- CCGACAAGCAGAAGAACGGCATCAA -6- carboxy-tetrafluorescein-3’), and 500 ng of total ... total DNA As a control for the total amount of DNA used in each reaction, GAPDH forward and reverse primers and a CY5 probe were also included in each sample tested A standard curve was prepared ... contribution of CA restriction by innate retroviral responses Methods Cell lines HeLa/CD4 (human squamous epithelial carcinoma) cells and human glioma cell NP2/CD4/CXCR4 [25] were maintained in Dulbecco’s...

Ngày tải lên: 13/08/2014, 01:20

11 489 0
w