a human rights supporting approach to debt for development

... that Australia and Indonesia entered into in 2010 came about In 2007 I applied for, and was lucky enough to receive, a major three-year Australian Research Council grant to explore debt- for- development ... sustainable financing for protected areas.116 In 2003 Germany undertook a debt- for- nature exchange with Madagascar in relation to debt that was excluded from HIPC treatment.117 Germany agreed to ... exchange in Madagascar’s history and has brought the Foundation’s total endowment to more than US$50 million.121 Melissa Moye and Jean-Paul Paddack, “Madagascar’s Experience with Swapping Debt for...

Ngày tải lên: 03/11/2014, 18:36

... which manipulate relevant language forms and, finally, produce a short text To write in a particular genre, whether a formal report or a historical romance, the formal patterns that shape a text ... Product Approach, Process Approach and Genre Approach were reviewed and their advantages and drawbacks were drawn out so that suitable writing techniques can be picked up and inappropriate ones can ... the most advantageous strengths of each approach and appropriately combine them into a synthetic approach so that the teaching and learning will be of maximum effect A synthesis of approaches will...

Ngày tải lên: 07/11/2012, 14:31

... Kristiansen TZ, Jonnalagadda CK, Surendranath V, Niranjan V, Muthusamy B, Gandhi TK, Gronborg M et al (2003) Development of human protein reference database as an initial platform for approaching systems ... Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total 1 2 3 4 All All All ... similar to BMP-1 ⁄ TLD-like metalloendopeptidases in that it acts as a procollagen C protease as well as an activator of lysyl oxidase Therefore, an important role for hmeprina ⁄ b may be ascribed to...

Ngày tải lên: 07/03/2014, 06:20

... Capacity Development Results Framework A strategic and results-oriented approach to learning for capacity development Samuel Otoo, Natalia Agapitova and Joy Behrens June 2009 Abstract The Capacity ... development goals Standard indicators for each capacity factor, adaptable to contexts Assessing capacity factors with reference to a hypothetical case The change process: improving capacity factors by ... that break the factors down into observable and measurable units Standard indicators for each capacity factor, adaptable to contexts The CDRF draws on various strands of economic literature to...

Ngày tải lên: 30/03/2014, 01:20

... the ACLIA1 development data for tuning a parameter for our baseline as shown in Section 4.2 (whereas our proposed method is parameter-free), and the ACLIA1 and ACLIA2 test data for evaluating ... Imamura, Genichiro Kikui, and Manabu Okumura 2010 A Web Page Summarization for Mobile Phones Transactions of the Japanese Society for Artificial Intelligence, 25:133–143 Jagadeesh Jagarlamudi, Prasad ... the 18th ACM conference on Information and knowledge management, CIKM ’09, pages 1589–1592 Association for Computing Machinery Ramakrishna Varadarajan and Vagelis Hristidis 2006 A system for query-specific...

Ngày tải lên: 30/03/2014, 21:20

... of formal education Formal education is an odd and unapproachable creature Although many of the same communication products are used in both informal (free-choice learning) and formal education ... Isbell (USA), Michael Cramer Andersen (Denmark), Monica G Salomone (Spain), Sune Nordentoft Lauritsen (Denmark), Megan Watzke (USA), Brooke A Paige (USA), Laura Miles (AlphaGalileo, UK), Anna Roth ... enough and has enough public appeal to merit a press release If it has, a press release has to be written that is accurate, true to the scientific data and also with an interesting angle to catch...

Ngày tải lên: 27/06/2014, 05:20

... look to larger meetings and collaborative actions with a broader range of participants The goals of this approach include: • To create a Think Tank or what Franklin Roosevelt described as "A Brain ... Alanko T, Kataja V, Asola R, Utriainen T, Kokko R, Hemminki A, Tarkkanen M, Turpeenniemi-Hujanen T, Jyrkkio S, Flander M, Helle L, Ingalsuo S, Johansson K, Jaaskelainen AS, Pajunen M, Rauhala ... strategies that could be tailored in LMCs for other forms of cancer as well Aims and hopes It is our aim to establish a scientific initiative to expand availability of resource sparing Breast Cancer...

Ngày tải lên: 09/08/2014, 04:21

... because animals and are non-parents The solutions obtained by the current approach are the same as the corresponding ones calculated according to AMs of Fernando and Grossman (1989) and van Arendonk ... derived an AM approach considering equations for total additive genetic merits and additive effects due to the MQTL, where MQTL equations for animals not typed and certain other animals are absorbed ... information on marker genotypes but also information on the parental origin of marker alleles Wang et al (1995) extended Fernando and Grossman’s work to situations where paternal or maternal...

Ngày tải lên: 09/08/2014, 18:22

... significant consequences: individuals are less able to access care and are increasingly vulnerable to infection and death, states are less able to realize the goals of universal access to treatment and ... such as education [20] and health care [21], and therefore are forced to pay all costs [15,21] Amnesty International has noted that the vast majority of internal migrants in China cannot afford ... right to the highest attainable standard of physical and mental health" and "in an urgent manner make every effort to: provide progressively and in a sustainable manner, the highest attainable standard...

Ngày tải lên: 11/08/2014, 14:21

... GGGGCCCTTTAGTGCCTTAG AATTGCCAAGTCAGAGGCAG 4,686 5,251 (+565) B TACTTACGGCAGAGGTTGGG TCTGATTTTGGAGCTTTTGG 6,411 6,017 (-394) A CTTGGGTTGGGAACTGAAAG CCTCTTCTGGGACTGCTGAC 28,006 4,925 (-23,081) C CCCACCAATGGATTACAACC ... bioinformatics leads, project management JS: laboratory lead, project management MM, CC: principal investigator, laboratory lead, project management All authors have read and approved the final manuscript ... Additional data files 13 The following additional data are available with the online version of this paper Additional data file provides additional details about the algorithms used to evaluate...

Ngày tải lên: 14/08/2014, 08:20

... perturbation-based approach to sensitivity analysis Numerical results 3.1 Design sensitivity analysis In this example, the perturbation-based sensitivity analysis approach (PSA) is applied to calculate ... differentiation approach based on the modified boundary integral equation presented by Rezayat and Burton [7] Based on this DSA, an optimal arrangement of circular holes is found to make the temperature ... perturbation-based approach using the boundary element method is developed to perform design sensitivity analysis This approach has the same accuracy as the conventional finite difference approach, ...

Ngày tải lên: 12/02/2014, 22:20

... therefore reasonable to conclude that kernel-based especially tree-kernel approaches are not suitable for Chinese, at least at current stage In this paper, we study a feature-based approach that ... incorporated the base phrase chunking information and semi-automatically collected country name list and personal relative trigger word list Jiang and Zhai (2007) then systematically explored a large ... three coarser structures , i.e nested, adjacent and separated, are used as feature, and a classifier is trained for each relation type and subtype; (2) similar to (1) but all nine structures are...

Ngày tải lên: 20/02/2014, 09:20

... Southampton, U.K., April R de Salvo Braz, R Girju, V Punyakanok, D Roth, and M Sammons 2005 An Inference Model for Semantic Entailment in Natural Language In Proceedings of AAAI-2005 S Harabagiu and ... links specific dates to more general time intervals For example, October 2000 entails the year 2000 These axioms are automatically generated before the search for a proof starts Additionally, the prover ... representations are generated from parse trees which are not always accurate ( 86% accuracy) Once syntactic and semantic parsers are perfected, the logical semantic approach shall prove its potential showed...

Ngày tải lên: 20/02/2014, 12:20

Ngày tải lên: 23/02/2014, 11:20

... switch The GAL regulatory network is composed of three regulatory proteins: a transcriptional activator Gal4p, a negative regulator Gal80p and a signal transducer Gal3p [6,7,20–23] Gal4p binds ... model) are formulated and solved (Appendix) The total concentrations of DNA, Gal4p, Gal3p and Gal80p, along with the various binding constants for the interactions were taken from literature and are ... at a given galactose (Gal) concentration to follow a Michelis–Menten saturation relationship:   Gal ½G3à Št ¼ ½G3Št KS þ Gal where, KS is the half saturation constant for activation of Gal3p...

Ngày tải lên: 07/03/2014, 16:20

... Y., Sato, I., Iwai, C., Kosaka, T., Ikeda, T & Nakamura, T (2001) Identification of human liver diacetyl reductases by nano-liquid chromatography/Fourier transform ion cyclotron resonance mass ... discomfort for the mice, which were maintained in accordance with the National Institutes of Health Guide for the care and use of Laboratory Animals All experiments were approved by the regional ... supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which corresponded to 13.2 ng insulin and 2.3...

Ngày tải lên: 17/03/2014, 10:20

Ngày tải lên: 17/03/2014, 17:20

... frequent in a prediction and it creates as many separate frames as are needed to give every participant/argument its own frame The remaining participants/arguments are added to the nearest frame For ... development data because the gold test data have not been made available 62 (1) IFN-alpha enhanced tyrosine phosphorylation of STAT1, STAT3, STAT4, STAT 5a, and STAT5b We use the IB1 algorithm as implemented ... Recognising arguments was the additional goal of Task in relation to Task Binding Gene Expr Localization Phosphorylation Protein Catab Transcription Regulation +Regulation -Regulation TOTAL Total 349...

Ngày tải lên: 23/03/2014, 13:20

... tagger is a probabilistic program that tags the words in the manual These tags consist of two parts - a mandatory syntactic portion, and an optional semantic portion For example: the word 'cancer' ... that the prepositional phrases are eventually attached to Table 1: Coni unction and Or but TOTAL their appropriate components, so that the phrase "in some herds" ultimately is attached to the adjective ... Lois; Agarwal, Rajeev; and Davis, Ron (1991) "Disambiguation of prepositional phrases in automatically labeled technical text." In Proceedings of the Ninth National Conference on Artificial Intelligence:l:...

Ngày tải lên: 23/03/2014, 20:20