a human model of asthma exacerbation
Báo cáo y học: " GITR signaling potentiates airway hyperresponsiveness by enhancing Th2 cell activity in a mouse model of asthma" ppt
Ngày tải lên :
12/08/2014, 14:20
... stimulation aggravates AHR and serum IgE responses in a mouse model of asthma GITR stimulation aggravates AHR and serum IgE responses in a mouse model of asthma A OVA-induced asthma model Sensitization: ... IL-10 and IL-13 and 10 pg/ml for IFNγ Statistical analysis All data are expressed as mean ± standard error of mean (s.e.m.) After log transformation, airway responsiveness to methacholine was statistically ... injection of OVA/Alum (day 1, 7) Challenge: OVA inhalation (day 21, 24, 27) DTA-1 treatment: hour before the first OVA challenge (day 21) AHR was measured before (day 18) and after (day 28) OVA challenges...
- 8
- 297
- 0
Báo cáo y học: " Role of lysophosphatidic acid receptor LPA2 in the development of allergic airway inflammation in a murine model of asthma" potx
Ngày tải lên :
12/08/2014, 14:20
... 5'-ATTGCCTCTGCAACATCTCG-3' Reverse: 5'-ATGAAGAAGGCCAGGAGGTT-3' LPA4 Forward: 5'-ACTGCGTTCCTCACCAACAT-3' Reverse: 5'-CGATCGGAAGGGATAGACAA-3' LPA5 Forward: 5'-GCTCCAGTGCCCTGACTATC-3' Reverse: 5'-CAGAGCGTTGAGAGGGAGAC-3' ... receptors and COX-2 LPA1 Forward: 5'-TCAACCTGGTGACCTTTGTG-3' Reverse: 5'-GGTCCAGAACTATGCCGAGA-3' LPA2 Forward: 5'-ATATTCCTGCCGAGATGCTG-3' Reverse: 5'-AAGCTGAGTAACGGGCAGAC-3' LPA3 Forward: 5'-ATTGCCTCTGCAACATCTCG-3' ... into alveolar space during allergic inflammatory response Airway goblet cell metaplasia and mucus production, indices of degree of inflammation, are hallmarks of asthma Goblet cell metaplasia and...
- 12
- 369
- 0
A mouse model of rhinovirus induced asthma exacerbation 4
Ngày tải lên :
01/10/2015, 17:26
... rhinovirus-induced asthma exacerbation mouse model Rhinovirus infection is widely regarded as the major factor causing asthma exacerbation and leading to the emergency department visits for asthmatic patients ... increase of MCP-1 was detected in sputum from patients with an aggravation of symptoms after acute asthma attack, compared with that from recovered patients 79 (Kurashima et al., 1996) Asthmatic ... bronchial tissue and lavage fluid from asthmatic patients (Conti and DiGioacchino, 2001; Dhaouadi et al., 2013; Saad-El-Din Bessa et al., 2012) In agreement with the clinical findings, animal OVA asthma...
- 31
- 260
- 0
A mouse model of rhinovirus induced asthma exacerbation 5
Ngày tải lên :
01/10/2015, 17:26
... inflammation peak and exacerbation Our model induced a fast eosinophilia exacerbation at day after last challenge, which is prior to the day peak in Bartlettʼs model Meanwhile, our model showed a ... Infective factors in exacerbations of bronchitis and asthma Br Med J 3, 323–327 Lambrecht, B.N., and Hammad, H (2012) The airway epithelium in asthma Nat Med 18, 684–692 Laza-Stanca, V., Stanciu, L .A. , ... S., Tsai, H.-J., Thyne, S., Navarro, D., Nazario, S., et al (2007) Association between IgE levels and asthma severity among African American, Mexican, and Puerto Rican patients with asthma J Allergy...
- 31
- 253
- 0
A mouse model of rhinovirus induced asthma exacerbation 2
Ngày tải lên :
01/10/2015, 17:26
... 1996; Dakhama et al., 1999) Efforts were also made to establish asthma exacerbation models via rhinovirus infection, the major cause of human asthma exacerbation However, more than 90% of rhinovirus ... establish asthma exacerbation model Traditionally, in vivo asthma models were established in animals sensitized and challenged by allergens Many species of animals, such as mice, rats, guinea ... Inc, Waltham, MA, USA) Both A2 60 /A2 80 (DNA/protein) and A2 60 /A2 30 (DNA/organic contaminants) ratios were recorded as an indicator of purity of RNA An acceptable level of purity for RNA extracts...
- 30
- 217
- 0
A mouse model of rhinovirus induced asthma exacerbation
Ngày tải lên :
01/10/2015, 17:26
... of asthma 1.1.3 Pathophysiology of asthma 1.2 Asthma exacerbation 1.2.1 Epidemiology of asthma exacerbation 1.2.2 Factors inducing asthma exacerbation ... and aggravate triggers and effectors (Lommatzsch, 2012) 1.2 Asthma exacerbation 1.2.1 Epidemiology of asthma exacerbation The natural history of asthma consists of relatively stable periods and ... with a greater risk of emergency department visits in African American with asthma (Erickson et al., 2007) An important character of asthma exacerbation is its seasonal cycles of eruption According...
- 32
- 247
- 0
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
Ngày tải lên :
09/08/2014, 07:20
... 5'-GCCTCCAGCATGAAAGTCTC, 3'-TAAAACAGGGTGTCTGGGGA), IL-1β (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 ... (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA), CC chemokine ligand (CCL)5 (formerly called RANTES; 5'-CGCTGTCATCCTCATTGCTA, 3'-GCTGTCTCGAACTCCTGACC), CCL2 (formerly called MCP-1; 5'-GCCTCCAGCATGAAAGTCTC, ... A, Ghosh S: Amelioration of acute inflammation by systemic administration of a cell-permeable peptide inhibitor of NF-κB activation Arthritis Rheum 2005, 52:951-958 20 Ariga A, Namekawa J, Matsumoto...
- 12
- 459
- 0
báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc
Ngày tải lên :
11/08/2014, 00:23
... a pattern of progressive adenocarcinoma with similar genetic changes and pathophysiology as seen in human breast cancers associated with BRCA1-mutations [11,12] Additionally, as in human BRCA1-associated ... University of Maryland, Baltimore animal facility and maintained in accordance with institutional guidelines approved by the University of Maryland, Baltimore Animal Care and Use Committee To compare ... enlarged view of a cell indicating the contact surfaces of the source and the drain is shown to the right of the wafer Gate voltage is applied at the back of the wafer Also indicated are the aligning...
- 6
- 329
- 0
Báo cáo y học: " Dimethylthiourea protects against chlorine induced changes in airway function in a murine model of irritant induced asthma" potx
Ngày tải lên :
12/08/2014, 11:22
... analysis of variance and for post hoc comparisons of means a Newman-Keuls test was used A p < 0.05 was accepted as significant All values are expressed as the mean + one standard error of the mean ... of pentobarbital (30 mg/kg) Subsequently, the animal was tracheostomized using at 18 gauge cannula and connected to a small animal ventilator (FlexiVent, Scireq, Montreal, Canada) Muscle paralysis ... in a safe manner JJT assisted with analysis of biological samples JGM was involved in the study design, in review of the data and in the preparation of the manuscript All authors read and approved...
- 15
- 253
- 0
Báo cáo y học: " Oral tolerance inhibits pulmonary eosinophilia in a cockroach allergen induced model of asthma: a randomized laboratory study" pptx
Ngày tải lên :
12/08/2014, 11:23
... pulmonary inflammation in a mouse model of allergic asthma Oral tolerization presents an attractive therapeutic option for human asthmatics in that it addresses the primary cause of allergic asthma ... http://www biomath.info/ The coefficient of variance was calculated as the ratio of the standard deviation and the mean of each data set or CV = standard deviation/mean Sacrifice and Data Collection ... significant advantage over standard therapeutic agents in that it addresses the fundamental cause of asthma rather than modifying downstream mediators In addition allergen desensitization has the advantage...
- 11
- 322
- 0
Báo cáo y học: " Modulation of lung inflammation by vessel dilator in a mouse model of allergic asthma" doc
Ngày tải lên :
12/08/2014, 14:20
... Natl Acad Sci USA 2005, 102(49):17723-17728 Thomas PG, Carter MR, Da'dara AA, DeSimone TM, Harn DA: A helminth glycan induces APC maturation via alternative NFkappa B activation independent of ... Vesely DL, Mohapatra SS: Atrial natriuretic peptide gene transfer by means of intranasal administration attenuates airway reactivity in a mouse model of allergic sensitization J Allergy Clin Immunol ... Inhibition of NPRA by small inferfering RNA against NPRA attenuated lung inflammation in a mouse model of asthma [10] There is a feedback regulation of the circulating concentration of natriuretic...
- 8
- 340
- 0
Báo cáo y học: " Pioglitazone is as effective as dexamethasone in a cockroach allergen-induced murine model of asthma" doc
Ngày tải lên :
12/08/2014, 15:21
... Sequences 5' GAGTGGGCTCACTTCCGATG 3' 5' GCTGAACACCTCACTGCTTGG 3' 5' CAACAACGACGAGAAGTTCTACTTATCCAAAG G 3' 5' CCAGCACCATCTCTACAACCC 3' 5' GCAAAGCTCCTGTTTGCACTC 3' 5' CCCAAACTATCTCAACCTCAGGGTCCACC 3' ... administration of × 109 pfu of AdCMV-VP16-PPAR-γ2 at the time of intranasal administration of CRA and again d later, at the time of IT CRA challenge Control mice received empty adenoviral vector at the same ... in murine models of asthma, the relevance to human disease of the models employed is unclear Recent data indicate that exposure to cockroach allergen plays an important role in asthma [19-21]...
- 10
- 273
- 0
Báo cáo y học: "A novel model of common Toll-like receptor 4- and injury-induced transcriptional themes in human leukocytes" pot
Ngày tải lên :
13/08/2014, 21:21
... 24:1009-1034 43 Takimoto M, Hamada A, Tomoda A, Ohdo S, Ohmura T, Sakato H, Kawatani J, Jodoi T, Nakagawa H, Terazono H, Koyanagi S, Higuchi S, Kimura M, Tukikawa H, Irie S, Saito H, Miike T: Daily expression ... streptavidin phycoerythrin and scanned on the Agilent Gene Array Scanner™ (Agilent Technologies) Analysis of microarray data We compiled a database that includes 38 Focus GeneChip® microarrays (Affymetrix) ... synthesis pathways Two additional pathways, a lipid metabolism pathway, and a cellular assembly and organization pathway, included, respectively, 71- and 68-TIR gene matches The top matching module...
- 11
- 252
- 0
Characterization of lung dendritic cells in a novel murine model of asthma
Ngày tải lên :
10/09/2015, 09:04
... disease, namely allergic asthma and non-allergic asthma as described earlier (Romanet-Manent et al., 2002) Allergic asthma, the most common type of asthma experienced by approximately 80% of asthmatic ... experimental models because of advantages such as the availability of various transgenic animals, the wide array of reagents available for analysis, the low cost of maintenance and the 20 CHAPTER 1: Introduction ... time occurrence and history of allergy and so on to facilitate the diagnosis of asthma 1.2 Animal model of asthma Clinical observations on asthmatic patients have laid the foundation knowledge...
- 205
- 413
- 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
Ngày tải lên :
25/10/2012, 11:48
... sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically synthesized ... system (Amersham Pharmacia Biotech, Uppsala, Sweden) Histone3 (Sigma, St Louis, MO, USA, 1:500) was used as an internal control Statistical analyses Data are expressed as mean ± standard deviation ... once daily for days, starting from day before CCI surgery Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal latency (PWL) to radiant heat and paw withdrawal threshold (PWT)...
- 9
- 487
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
Ngày tải lên :
15/02/2014, 01:20
... Pro transmission scanner (Epson, Nagano, Japan) and analyzed with imagemaster 2d platinum software, version 5.0 (GE Healthcare) Spots were detected automatically by the software and manually refined; ... Germany) Capillary voltage was 1.5–2 kV and a dry gas flow rate of 10 LÆmin)1 was used with a temperature of 230 °C The scan range was 300–1800 m ⁄ z The tandem mass spectra were annotated and peak list ... eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄ L12, annexin A2 , annexin A5 , aldolase A, fascin and peroxyredoxin 1] displayed quantitative differences, regardless of whether or not a- synuclein...
- 11
- 775
- 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
Ngày tải lên :
20/02/2014, 02:21
... Systems Modelling Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway ... can be calculated as follows: ELISA assays were carried out using rabbit antibodies raised against the recombinant proteins [12,14] and puried proteins as standards We measured that an extract ... with KALEIDAGRAPH (Abelbeck Software, Reading, PA, USA) A series of constant or changing values were generated for the dierent input variables and the calculations were done using the appropriate...
- 13
- 906
- 0
Tài liệu Báo cáo khoa học: "A Shallow Model of Backchannel Continuers in Spoken Dialogue" potx
Ngày tải lên :
22/02/2014, 02:20
... what the humans in the corpus One difficulty with evaluating a model such as ours is that human speakers differ markedly in their own backchanneling behaviour As Ward and Tsukahara (2000) remark, ... carrying out a human evaluation of these models it would be hard to decide between a Three Trigram model with a pause threshold of 600ms and a Ten Trigram model with a threshold of 900ms Evaluation ... 90% or above are not uncommon for tasks such as part -of- speech tagging and statistical parsing, this can be at least partly explained by the fact that humans vary widely in how many of their opportunities...
- 8
- 651
- 0
Báo cáo khoa học: "A Hierarchical Model of Web Summaries" docx
Ngày tải lên :
07/03/2014, 22:20
... summaries, this model can be readily adapted to any Web-related content that can be seen as a mixture of the component topics appearing along a paths in the hierarchy Such model can become a key ... (SIGIR’00), pages 144–151 David M Blei and J Lafferty 2009 Topic models In A Srivastava and M Sahami, editors, Text Mining: Theory and Applications Taylor and Francis David M Blei, Andrew Ng, and Michael ... USA ACM Joseph Reisinger and Marius Pa¸ca 2009 Latent varis able models of concept-attribute attachment In ACLIJCNLP ’09: Proceedings of the Joint Conference of the 47th Annual Meeting of the ACL...
- 6
- 422
- 0