a geometric construction of modular categories

Đề tài " A new construction of the moonshine vertex operator algebra over the real number field " pot

Đề tài " A new construction of the moonshine vertex operator algebra over the real number field " pot

... to transform framed VOAs into other framed VOAs An advantage of our ways is that we can construct many framed VOAs from smaller pieces As basic pieces, we will use a rational Virasoro VOA L( ... framed VOA As applications, we study the five framed VOA structures on VE8 and construct many framed VOAs including V from a small VOA One of the advantages of our construction is that we are able ... particular, a | a ∈ L2 is an elementary abelian 2-subgroup of Aut(VL ) If a, b is odd for a, b ∈ L2 , then τb (e± (a) ) = e∓ (a) Proof Since a, L ∈ Z and a, a = 4, L ⊆ Za ⊕ a ⊥ In particular,...

Ngày tải lên: 28/03/2014, 22:20

63 423 0
báo cáo hóa học:" A biomechanical assessment of modular and monoblock revision hip implants using FE analysis and strain gage measurements" potx

báo cáo hóa học:" A biomechanical assessment of modular and monoblock revision hip implants using FE analysis and strain gage measurements" potx

... model and experimental strain at Locations to were calculated as described earlier For the Modular hip implant data (Table 1), the average differences for Locations to at axial loads of 700 and ... mechanical testing, and data analysis HB, RZ, and MM did the literature search, manuscript writing, figure preparation, and data analysis MP and PZ did extensive re-reading of the manuscript PZ and ... storage and analysis Mechanical testing Experiments were performed using an Instron 8874 (Canton, MA, USA) with a capacity of ± 25 kN, a resolution of 0.1 N, and an accuracy of ± 0.5% Hip implants...

Ngày tải lên: 20/06/2014, 04:20

12 333 0
Báo cáo y học: "A geometric analysis of hallux valgus: correlation with clinical assessment of severity" pptx

Báo cáo y học: "A geometric analysis of hallux valgus: correlation with clinical assessment of severity" pptx

... perpendicular bisectors of the longitudinal axes of the first metatarsal and proximal phalanx; PPAA: Proximal phalangeal articular angle; SAS: Statistical analysis system; SD: Standard deviation; VAS: ... 0.531° of HVA and 0.07° of IMA, and an increases of 0.04° of PPAA of the remaining angles for each case are maintaned unchanged The application of these data to a theoretical model shows that for ... based on angular measurements is shown in Table Angular values showed a mean (± standard deviation, SD) values of 30.3 HVA: Hallux valgus angle IMA: Intermetatarsal angle PPAA: Proximal phalangeal...

Ngày tải lên: 10/08/2014, 21:23

8 425 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated without purification The mixture of diols 22 so obtained was oxidized ... broadening of some signals was observed in its 13C NMR spectrum, presumably due to the conformational flexibility of this compound. 2a, 3a No spectrum of the natural compound was available for a...

Ngày tải lên: 26/01/2016, 09:27

3 547 0
(Cambridge studies in linguistics 82) john m  anderson a notional theory of syntactic categories cambridge university press (1997)

(Cambridge studies in linguistics 82) john m anderson a notional theory of syntactic categories cambridge university press (1997)

... with a particular configuration and thus acquire a syntactic domain; they are manifested primarily as concord Again, such attachments are appropriate to the characterisation of suprasegmental structure, ... subject-predicate distinction is apparently a grammaticalisation of (the typical manifestation of) topic-comment But another factor enters here Languages typically accord a special status to animate, particularly ... shall also be assuming, as again anticipated in chapter 1, that in the representation of a particular category one feature may predominate over another - the combination may be asymmetrical - and...

Ngày tải lên: 26/10/2016, 08:45

366 619 0
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt

GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt

... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative ... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... current account of the national balance of payments (in case of a surplus this amount appears with a negative sign); from national institutions capital account: \ purchases of existing non-financial...

Ngày tải lên: 06/03/2014, 21:20

30 520 0
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx

Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx

... a tremendous amount of memory With 50,000 nouns, we would initially require a 50,000 x 50,000 array of values (or a triangular array of about half this size) With our current hardware, the largest ... looking at the nearest NP on each side of a particular NP Roark and Charniak (1998) built on that work by actually using conjunction and appositive data for noun clustering, as we here (They also ... five hand-selected categories, each with a single hypernym, and the 20 nouns their algorithm scored as the best members of each category, at least one judge marked on average about 31% of the...

Ngày tải lên: 08/03/2014, 06:20

7 418 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: "Tagging Inflective Languages: Prediction of Morphological Categories for a Rich, Structured Tagset" docx

Báo cáo khoa học: "Tagging Inflective Languages: Prediction of Morphological Categories for a Rich, Structured Tagset" docx

... The Training Data Our training data consists of about 130,000 tokens of newspaper and magazine text, manually doubletagged and then corrected by a single judge Our training data consists of about ... the case of tagging Tagging can be seen as a "final application" problem for which we assume to have enough data at hand to train and use just one model, abandoning the source-channel paradigm ... tokens of newspaper and magazine text, manually tagged using a special-purpose tool which allows for easy disambiguation of morphological output The data has been tagged twice, with manual resolution...

Ngày tải lên: 17/03/2014, 07:20

8 276 0
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

... that an airman is capable of tolerating Additional applications, such as the use of the processed electromyography (EMG) signal as a measure of muscle fatigue and pain as well as an analysis of ... easily prepared by anodic treatment, resulting in electrode plates that have a dc resistance greater than GΩ and a capacitance of 5000 pF at Figure 1.10 Block diagram of a typical capacitive active ... primarily of dead, dried-up cells which have a high resistance and capacitance For a 1-cm2 area, the impedance of the stratum corneum varies from 200 kΩ at Hz down to 200 Ω at MHz Mechanical abrasion...

Ngày tải lên: 29/03/2014, 11:20

478 526 2
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
báo cáo hóa học:" Interpretation of response categories in patient-reported rating scales: a controlled study among people with Parkinson''''s disease" pot

báo cáo hóa học:" Interpretation of response categories in patient-reported rating scales: a controlled study among people with Parkinson''''s disease" pot

... alternative categories in some cases were marginal Our observations also illustrate problems associated with raw rating scale data that clinicians and investigators need to be aware of and that argue ... Catechol-O-methyl transferase; FACIT-F: Functional Assessment of Chronic Illness Therapy - Fatigue; FDA: Food and Drug Administration; MANOVA: Multivariate analysis of variance; MAO: Monoamine oxidase; mm: ... study, data collection, data analyses and interpretation, and drafting of the manuscript HR participated in designing the study, data collection, data analyses and interpretation JR participated...

Ngày tải lên: 20/06/2014, 16:20

9 384 1
Báo cáo hóa học: " A new interpretation of Jensen’s inequality and geometric properties of -means" pptx

Báo cáo hóa học: " A new interpretation of Jensen’s inequality and geometric properties of -means" pptx

... Tominaga, M: An estimate of Young type operator inequality and Specht ratio RIMS Kôkyûroku 1259, 173–178 (2002) (in Japanese) Hara, T, Uchiyama, M, Takahasi, S-E: A refinement of various mean inequalities ... Lemma and the above argument □ (ii) Similarly Nakasuji et al Journal of Inequalities and Applications 2011, 2011:48 http://www.journalofinequalitiesandapplications.com/content/2011/1/48 Page of ... for all x Î I° (ii) The following two statements are equivalent: Page 11 of 15 Nakasuji et al Journal of Inequalities and Applications 2011, 2011:48 http://www.journalofinequalitiesandapplications.com/content/2011/1/48...

Ngày tải lên: 21/06/2014, 00:20

15 356 0
Summary of Ph.D thesis: A study on the embankment caculation method reinforced by geotextile in the construction of highway in Vet Nam

Summary of Ph.D thesis: A study on the embankment caculation method reinforced by geotextile in the construction of highway in Vet Nam

... (Hanoi) , before spreading the layer of macadam people to spread a layer of geotextile Specifications for separating the sand embankment that separates below the mixed layer between the sand and ... software program a Geo.Slope Software ( Canada ) [10] , [11] , [12] , [20] , [22] Stability calculations : Theoretical Foundations of stability calculation in the program Geo.Slope balance of ... changes in the input parameters ( geometrical shapes , materials , parameters ) and can edit , write additional computational needs , user research - 18 The content of research, empirical calculations...

Ngày tải lên: 02/07/2014, 20:44

31 563 0
Báo cáo toán học: " A NEW CONSTRUCTION FOR CANCELLATIVE FAMILIES OF SETS" doc

Báo cáo toán học: " A NEW CONSTRUCTION FOR CANCELLATIVE FAMILIES OF SETS" doc

... we may take all the 1-element sets Let Hn be the family of all 1-element sets of a n-set It had been conjectured that the largest cancellative families could be built up by taking products of ... can be made in m3m−2 ways We now form a cancellative family of subsets of a 3m-set containing m3m−2 elements as follows Identify subsets of a 3m-set with 0,1 vectors of length 3m in the usual ... European Journal of u Combinatorics (1984), 127–131 [3] G.O.H Katona, Extremal Problems for Hypergraphs, Combinatorics, Mathematical Centre Tracts part 56 (1974), 13–42 [4] A. F Sidorenko, The Maximal...

Ngày tải lên: 07/08/2014, 06:20

3 327 0
Báo cáo toán học: "Weakly Self-Avoiding Words and a Construction of Friedman" ppt

Báo cáo toán học: "Weakly Self-Avoiding Words and a Construction of Friedman" ppt

... Theory A Also available at [2] H Friedman Enormous integers in real life Manuscript, dated June 2000, available at ... expect results as strange as Friedman’s, since there are no infinite anti-chains for the partial order defined by “x is a subsequence of y”, while there are infinite anti-chains for the partial order ... minimal in the sense that any proper prefix is weakly self-avoiding Now we use a classical breadth-first tree traversal technique, as follows: We maintain a queue, Q, and initialize it with the empty...

Ngày tải lên: 07/08/2014, 06:22

4 227 0
Báo cáo toán học: "A prolific construction of strongly regular graphs with the n-e.c. property" pptx

Báo cáo toán học: "A prolific construction of strongly regular graphs with the n-e.c. property" pptx

... q The Paley graphs are n-e.c whenever q > n2 22n−2 ; see Bollob´s and Thomason [3] Recently a Bonato, Holzmann and Kharaghani [4] have used Hadamard matrices to construct new 3-e.c graphs Even ... Fon-Der-Flaass [6] has found prolific constructions of strongly regular graphs using a ne designs (He points out that some of these constructions appeared in Wallis [10].) His main construction appears ... regular graph Each of the four designs has as blocks all 2-subsets of a 4-set; the design Si is labelled with a bold numeral i in a square The top of the figure shows the numbering of the parallel...

Ngày tải lên: 07/08/2014, 06:23

12 222 0
Báo cáo khoa học: "Polyhedral representation of crown shape. A geometric tool for growth modelling" ppsx

Báo cáo khoa học: "Polyhedral representation of crown shape. A geometric tool for growth modelling" ppsx

... Foliar weight and area related to current sapwood area in oak For Sci 25, Granier A, Anfodillo T, Sabatti M et al (1994) Axial and radial water flow in the trunk of oak trees: a quantitative and ... tertiary branches attached to the secondary branches From these data, we calculated the Cartesian coordinates (x,y,z) of the origin and tip of each growth unit A stem analysis gave basal area (at ... surface area) and measurements of tree growth (annual basal area and bole volume increments) A strong allometric relation exists between the measured tree basal area and calculated crown surface...

Ngày tải lên: 08/08/2014, 19:21

10 345 0
Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt

Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt

... RE: MapChart: Software for the graphical presentation of linkage maps and QTLs J Hered 2002, 93:77-78 Fanarraga ML, Parraga M, Aloria K, del Mazo J, Avila J, Zabala JC: Regulated expression of ... that Placozoa are basal relative to all other non-Bilaterian animals ([70], but see [71]) Whole genome analysis of placozoan T adhaerens shows that the placozoan genome has the lowest amount of ... 14 additional markers were added at LOD = 2.5 After data partitioning by the Joinmap 4.0 program, the maternal (1:1 female type) and paternal (1:1 male type) datasets contained 167 and 155 markers,...

Ngày tải lên: 09/08/2014, 20:20

17 269 0
w