a general solution to the challenge of activex

Alive by meeting: A solution to the paradox of meetings based on the pyramid of new collaboration

Alive by meeting: A solution to the paradox of meetings based on the pyramid of new collaboration

... construction of the JKB relating to the task at hand And at the same time, the JKB functions as a basis for accomplishing the task on which the team is working (see Fig 3) and can also be seen as an essential ... knowledge bases in these individual areas, it would be more appropriate to speak of taken-asshared rather than shared knowledge The notion of a taken-as-shared knowledge or meaning implies that individual ... interactions and 2) the principal function of the leader needs to be that of a facilitator of collaborative problem-solving The objective is to greatly improve the quality of meetings, trying to

Ngày tải lên: 27/09/2020, 15:01

11 36 0
Expert Witness Malpractice: A Solution to the Problem of the Negligent Expert Witness

Expert Witness Malpractice: A Solution to the Problem of the Negligent Expert Witness

... admissibility of scientific evidence; Americans' love of science and awe of scientists; and attorneys' need, both actual and perceived, to call in specialists to aid them at trial.2 Perhaps the most ... familiarity with handwriting and typewriting examination is able to qualify in the eyes of the trial judge Not even formal academic education or a baccalaureate degree is necessary Handwriting teachers, ... stand to explain why physical evidence is absent The unexplained absence of such evidence may lead jurors to conclude that the prosecution has failed to make its case The media has influenced the

Ngày tải lên: 04/11/2022, 07:30

35 8 0
Research " A THESIS SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA " potx

Research " A THESIS SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA " potx

... such as FASB Trang 14 comparability of software companies’ performance In an attempt to curtail the diversity in practice, the SEC announced a moratorium on the capitalization of software development ... March 1996 What factors could motivate the dramatic reversal of the software firms’ attitude toward the capitalization rule they supported in the early 1980s? Aboody and Lev (1998) provide a ... statistic is significant at the 0.0001 Trang 20 Taken together, an analysis of 43 capitalizers indicates that capitalization seems to result in higher earnings variability The increased earnings

Ngày tải lên: 07/03/2014, 02:20

87 524 0
Research " A DISERTATION SUMMITTED TO THE SCHOOL OF EDUCAITON AND THE COMITEE ON GRADUATE STUDIES OF STANFORD IN PARTIAL FUFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY " doc

Research " A DISERTATION SUMMITTED TO THE SCHOOL OF EDUCAITON AND THE COMITEE ON GRADUATE STUDIES OF STANFORD IN PARTIAL FUFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY " doc

... men and women On the other hand, rewards for higher education are substantial and are increasing in “primary Wel Trang 21 graduate education have been able to approach and even surpass their Anglo-American ... by Bartel and Sicherman (1999) matches a variety of industrial-level measures of technological change to a panel of young variables: growth of capital-labor ratios and growth of employment The ... across educational groups were due to the decline in the real value of the minimum wage in the 1980s, to the increase in the pace of technological change, to the changes in the labor supply of white

Ngày tải lên: 23/03/2014, 05:22

159 484 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

... notice that this time the tolerance mask is always touched by the magnitude response This can be traced back to the fact that, for the SFB, the steps of the tolerance mask are much smaller, not ... delay was proposed that is based on the Remez exchange algorithm With the mentioned approaches a filter group EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges ... filter banks with an approximately linear-phase frequency response in the passband and the transition bands As the objective function to be minimised we adopt a particular representation of the group

Ngày tải lên: 21/06/2014, 19:20

13 624 0
Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx

Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx

... However, there is a clever way to extract information from this matrix without going into involved mathematical anal- ysis. The idea is to optimize the above scattering equation using a variation approach ... as a channel variable As noted so far, the key point in dealing with MIMO and its performance is how to model the random channel matrix H . The latter is in general a non Hermitian rectangular ... b  with a = b. To make contact with the variational analysis given above, this difference can also be read as |r ab =|r a  + |δr a . Then compute the minimum of the distance |r ab  min

Ngày tải lên: 22/06/2014, 19:20

10 549 0
Báo cáo hóa học: "ENTIRE POSITIVE SOLUTION TO THE SYSTEM OF NONLINEAR ELLIPTIC EQUATIONS" docx

Báo cáo hóa học: "ENTIRE POSITIVE SOLUTION TO THE SYSTEM OF NONLINEAR ELLIPTIC EQUATIONS" docx

... [12] O. A. Ladyzhenskaya and N. N. Ural’tseva, Linear and Quasilinear Elliptic Equations,Academic Press, New York, 1968. [13] A. Nachman and A. Callegari, A nonlinear singular boundary value problem ... nonlinear degenerate parabolic problems, Annali di Matematica Pura ed Applicata, Serie Quarta 136 (1984), 35–48. [6] A. L. Edelson, Entire solutions of singular elliptic equations, Journal of Mathematical ... boundary layer theory, Journal of Mathematical Analysis and Applications 64 (1978), no. 1, 96–105. [4] D. G. de Figueiredo and J. Yang, Decay, symmet ry and existence of solutions of semilinear elliptic

Ngày tải lên: 22/06/2014, 22:20

11 406 0
A Pragmatic Introduction to the Art of Electrical Engineering pdf

A Pragmatic Introduction to the Art of Electrical Engineering pdf

... to the Software? The PC needs special software to let you program and communicate with the Stamp Copies of this software are available from the Parallax web... (which we’ll explain ... momentarily), and use a custom made serial cable and a 9V battery clip The manual shows a picture of the Basic Stamp 2 and details all the connections This figure also appears below ... right next to where it says “Parallax.” A solderless breadboard (sometimes referred to as a Proto-Board, the brand name of a particular manufacturer) allows you to make connections

Ngày tải lên: 08/08/2014, 09:22

141 772 0
Báo cáo toán học: "A probabilistic approach to the asymptotics of the length of the longest alternating subsequence" pdf

Báo cáo toán học: "A probabilistic approach to the asymptotics of the length of the longest alternating subsequence" pdf

...  . Then, for a ny bilateral sequence a ∈ [q] Z , we have 1  a (n) has a local maximum at k  = 1 (a has a local maximum at k) + 1 A k (a) , if k < n, and 1  a (n) has a local maximum at ... mean and variance are ob- tained. Let us just say that, to date, the proofs developed to solve these problems are of a combinatorial or a nalytic nature and that we wish below t o provide probabilistic ... maxima of a + # local minima of a = 1 (a has a local maximum at n) + 2 n−1  k=1 1 (a has a local maximum at k) . Now, the only difficulty in adapting the proof of Theorem 2.2 t o our current framework

Ngày tải lên: 08/08/2014, 12:23

19 428 0
A practical guide to the management of medical emergencies - part 1 ppt

A practical guide to the management of medical emergencies - part 1 ppt

... arrest: a 3-phase time-sensitive model JAMA 2002; 288: 3035–38 Cardiac arrest Aim 17 Cardiac arrhythmias: general approach 3 Cardiac arrhythmias: general approach Cardiac arrhythmia Yes Cardiac ... No Stabilize airway and... the AV node and back via the accessory pathway) – Fast conduction of atrial fibrillation down the accessory pathway (broad complex, irregular) – Rarely, antidromic ... principles • Stabilize airway and breathing: maintain arterial oxygen saturation >90% • Correct major arrhythmia... management of the airway 2 Respiratory rate Respiratory rate 30/min Give

Ngày tải lên: 10/08/2014, 18:21

66 361 0
A practical guide to the management of medical emergencies - part 2 pot

A practical guide to the management of medical emergencies - part 2 pot

... Antihistamines Paracetamol Salicylates... tests • Arterial blood gases and pH (respiratory alkalosis in early stage, progressing to metabolic acidosis) • Plasma paracetamol level (sample taker ... indications* and contraindications† Multiple-dose activated charcoal may be indicated Single-dose activated charcoal may be indicated Barbiturates Carbamazepine Dapsone Paraquat Quinine Theophylline ... reading American Academy of Clinical Toxicology, European Association of Poisons Centres and Clinical Toxicologists Position paper: gastric lavage Clin Toxicol 20 04; 42: 933–43 American Academy

Ngày tải lên: 10/08/2014, 18:21

66 376 0
A practical guide to the management of medical emergencies - part 4 doc

A practical guide to the management of medical emergencies - part 4 doc

... microscopy Further reading American College of Cardiology and American Heart Association. Guidelines for the management of patients with valvular heart disease (2006). American College of Car- diology ... Management and follow up of prosthetic heart valves. Heart 2004; 90: 818–24. Cardiac valve disease and prosthetic heart valves TABLE 30.3 Causes of acute pulmonary edema in native and prosthetic ... pulmonary edema should be excluded by clinical assessment, ECG and echocardiography Cardiac valve disease and prosthetic heart valves 30 Cardiac valve disease and prosthetic heart valves 194 Further

Ngày tải lên: 10/08/2014, 18:21

66 320 0
A practical guide to the management of medical emergencies - part 5 docx

A practical guide to the management of medical emergencies - part 5 docx

... The mechanisms, diagnosis, and management of severe asthma in adults. Lancet 2006; 368: 80–93. 258 SPECIFIC PROBLEMS: RESPIRATORY Acute asthma TABLE 39.3 Further management of acute severe asthma ... and monitoring in acute asthma Arterial blood gases • Check arterial blood gases if there are clinical signs of a severe or life-threatening attack (Table 39.1) or if arterial oxygen saturation ... focal shadowing indicative of pneumonia, or pneumothorax) • Arterial blood gases and pH • ECG • Echocardiography if there are clinical signs of congestive heart failure, raised plasma brain natriuretic

Ngày tải lên: 10/08/2014, 18:21

66 339 0
A practical guide to the management of medical emergencies - part 6 doc

A practical guide to the management of medical emergencies - part 6 doc

... Acetazolamide Clonazepam Phenobarbital Clobazam Focal at onset Carbamazepine Lamotrigine Valproate* Gabapentin Levetiracetam Pregabalin Tiagabine Zonisamide Acetazolamide... compression Transverse ... NEUROLOGICAL Subarachnoid hemorrhage TABLE 49.4 Urgent investigation in suspected subarachnoid hemorrhage CT of the brain • Blood in subarachnoid spaces • May show intracerebral hematoma Lumbar puncture ... stockings and LWH heparin Prophylaxis against gastric Give proton pump inhibitor stress ulceration Fits Manage along standard lines (p. 349) Prophylactic anticonvulsant therapy not indicated

Ngày tải lên: 10/08/2014, 18:21

66 312 0
A practical guide to the management of medical emergencies - part 7 pdf

A practical guide to the management of medical emergencies - part 7 pdf

... potassium, creatinine and urea* • Liver function tests: bilirubin, aspartate transaminase, alanine transaminase, gamma-glutamyl transferase, alkaline phosphatase, albumin • Amylase and lipase ... Diagnosis made by imaging and biopsy Cause unclear Retake the drug history Consider transjugular liver biopsy ALF, acute liver failure; ALT, alanine aminotransferase; AST, aspartate aminotransferase; ... Pancreatic... endocarditis (p 203) and myeloma as causes of renal failure • Has renal failure followed cardiac catheterization via the femoral artery (raising the possibility of renal atheroembolism)?

Ngày tải lên: 10/08/2014, 18:21

66 320 0
Báo cáo hóa học: " A general solution to the continuous-time estimation problem under widely linear processing" pdf

Báo cáo hóa học: " A general solution to the continuous-time estimation problem under widely linear processing" pdf

... twice as great as the SL estimator Notice also that the Hilbert space approach we have followed to derive the WL estimators allows us to give an alternative proof of the well-known fact that WL ... interval of the real line As noted above, this formulation is very general and contains as particular cases a great number of classical estimation problems, such as estimation of signals in additive ... stabilization of the MS errors for t ≥ Apart from the better performance of the WL estimator with respect to the SL estimator (as was to be expected), the rapid convergence of the RR estimators...

Ngày tải lên: 20/06/2014, 22:20

11 489 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

... et al., 2008) with the median sample size calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner ... bias? Use of valid and reliable paper and pencil measures a Sub-total Results Confounding variables controlled Generalisable results? Sub-total Total score Fabiani et al (1996) Fabiani et al (2000) ... such a feature, indicates partial evidence, and indicates there was definitely evidence for such a feature in the study A further adaptation was sorting of the categories to be scored As the studies...

Ngày tải lên: 12/02/2014, 12:20

171 709 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum of the values of the omcA– and the omcB– mutants revealed that there is no statistically significant...

Ngày tải lên: 07/03/2014, 09:20

11 732 0
A further contribution to the study of the mortuary customs of the North American Indians docx

A further contribution to the study of the mortuary customs of the North American Indians docx

... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the ... ceases, at the end of the year, they have high mass said for the benefit of the soul of the departed; after this they again appear upon the arena of their wild sports and continue to be gay and happy...

Ngày tải lên: 08/03/2014, 13:20

108 604 0
The road to reality   a complete guide to the laws of the universe    penrose, roger

The road to reality a complete guide to the laws of the universe penrose, roger

... control the behaviour of the world and whatever their relations might be to mathematical truth This realization that the key to the understanding of Nature lay within an unassailable mathematics was ... in the time of Pythagoras What about the geometrical theorems that the Pythagoreans had obtained using their procedures of mathematical proof? They too have a clear validity today, but now there ... heavens As he stood there, a dark cloud became apparent at the head of the beam, giving the whole structure the appearance of a distant giant parasol, glowing evilly, with a smoky Xaming staV The...

Ngày tải lên: 17/03/2014, 14:53

1,1K 542 4
w