a free genetic programming toolbox for matlab
Intelligent Control and Computer Engineering
... Retrieval Using Thai Law Ontology 177 Tanapon Tantisripreecha and Nuanwan Soonthornphisaj Genetic Algorithm Based Model for Effective Document Retrieval 191 Hazra Imran and Aditi Sharan An ... 119 Jeonghwan Gwak and Kwang Mong Sim Policy Gradient Approach for Learning of Soccer Player Agents 137 Harukazu Igarashi, Hitoshi Fukuoka, and Seiji Ishihara Genetic Algorithm for Forming ... Closed Quantum Computation Systems Using Neural Estimation and LMI Transformation Anas N Al-Rabadi Optimal Guidance and Control for Space Robot Operation Takuro Kobayashi and Shinichi...
- 328
- 585
- 0
Báo cáo hóa học: " Research Article A T-S Fuzzy Model-Based Adaptive Exponential Synchronization Method for Uncertain " docx
... Journal of Inequalities and Applications infinite dimensional in nature and time-delay is, in many cases, a source of instability The stability issue and the performance of time delayed systems are, ... that can be readily checked by using some standard numerical packages 33 This paper is organized as follows In Section 2, we formulate the problem In Section 3, a fuzzy adaptive exponential ... Nonlinear Science Series A: Monographs and Treatises, World Scientific, River Edge, NJ, USA, 1998 C.-C Wang and J.-P Su, A new adaptive variable structure control for chaotic synchronization and...
- 14
- 270
- 0
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt
... i.e., TargetScan and DIANA-microT, achieve a relatively low sensitivity and predict a small number of targets The miRanda was shown to provide a substantially better sensitivity as a trade-off for ... thousand fewer miR-mRNA interactions Another survey that investigated several traditional predictors including PicTar, TargetScanS, miRanda, and RNAhybrid [8], concludes that miRanda and RNAhybrid ... Finally, we also estimate the computational complexity of the proposed method Table 1: Datasets Dataset name Dataset details Dataset goal Design set 66 human miR-mRNA duplexes published in TarBase...
- 12
- 621
- 0
Báo cáo khoa học: "Multilingual Transliteration Using Feature based Phonetic Method" docx
... are same as in Tao et al (2006) Swan & Smith (2002)’s study covers 25 languages including Asian languages such as Thai, Korean, Chinese and Japanese, European languages such as German, Italian, ... non-transliteration pairs are composed of an English named entity and a random word from the target language newspaper a For all the training data, the pairs of pronunciations are aligned using standard ... of training data for each language Experiment and Results The linear function was trained for each language, separately 500 transliteration pairs were randomly selected from each transliteration...
- 8
- 171
- 0
Báo cáo khoa học: "Designing a Task-Based Evaluation Method ology for a Spoken Machine Translation System" pot
... focus on whether goals are communicated, rather than whether they are achieved Goals of a Task-Based Evaluation Methodology for an MT System The goal of a task-based evaluation for an MT system is ... Communication and Technology, pages 1423-1426 M.Walker, D.J.Litman, C .A. Kamm, and A. Abella 1997 PARADISE: A framework for evaluating spoken dialogue agents Technical Report T R 97.26.1, AT and T ... goals; cross-domain goals often serve a meta-level purpose in the dialogue We can thus evaluate performance over all goals while maintaining a clear performance measure for in-domain goals Scores...
- 4
- 365
- 0
Báo cáo " ENVIRONMENTAL EDUCATION BY PROBLEM BASED LEARNING METHOD (PBL) - BENEFITS AND REMAINING ISSUES - APPLY IN TEACHING CLEANER PRODUCTION SUBJECT IN HO CHI MINH CITY UNIVERSITY OF TECHNOLOGY " pdf
... knowledge Learners have access to immediate problems in the early stages of a teaching unit The problem may be a natural phenomenon or an event / situation was, is or may in fact occur and contain things ... teachers not? What makes a teacher? The individual characteristics - Sex: female teachers generally tolerant and motivate students, male teachers often follow the department - Age: In the early ... University City was a major positive signal The following students were crestfallen time gradually acquainted, and know how to adapt organizational learning, explore materials, self-study and discussions...
- 9
- 591
- 0
Evaluating Progress of the U.S. Climate Change Science Program: Methods and Preliminary Results pdf
... Jersey Edward A Boyle, Massachusetts Institute of Technology, Cambridge F Stuart Chapin, University of Alaska, Fairbanks Grant Davis, Sonoma County Water Agency, Santa Rosa, California Mark Fahnestock, ... the San Francisco Bay area, California, based on U.S Geological Survey elevation data and imagery from the National Agriculture Imagery Program SOURCE: San Francisco Bay Conservation and Development ... system and a national climate service Trades within the program can also be made to expand current activities and advance research on modeling, user-driven research, and adaptation, mitigation, and...
- 267
- 452
- 0
Báo cáo khoa học: "A Tabulation-Based Parsing Method that Reduces Copying" docx
... constraint logic programming techniques to more recent constraint-based grammatical theories Relational predicates also make grammars more modular and readable than pure phrasestructure-based grammars ... Resource Grammar and a handful of Lexical-Functional Grammars, the results are by no means graceful, not at all modular, and arguably not reusable by anyone except their designers The particular interest ... empty categories already partially evaluated once on Rs, and RAs — an accumulator of rules already used in partial evaluation once on Es Initialize Es to empty cats of grammar; initialize Rs to rules...
- 8
- 209
- 0
Shaping Women’s Health Research: Scope and Methodologies pptx
... Inuit Report and Recommendations Ottawa: Inuit Tapirisat of Canada Archibald, Linda and Phillip Bird, Claudia Brann, Martha Greig, Eeta Kanayuk, Patricia Kaufert, John O’Neil, and Sally Webster ... Canadian-born to Caribbean, to Somali, to Namibian, and more As well, the US National Cancer Institute speculated that lesbians are at higher risk of breast cancer (Plumb 1997) What about Black ... Bailey, Natasha; Maria Gurevich and Cynthia Mathieson Queering Health: Why Talk About Community? Unpublished paper, funded by the Medical Research Council of Canada, Ottawa Ballweg, Mary Lou and...
- 22
- 347
- 0
Báo cáo khoa học: "Complementing Word Net with Roget''''s and Corpus-based Thesauri for Information Retrieval" pdf
... non-terminals and was automatically extracted from Penn Tree Bank syntactically tagged corpus developed at the University of Pennsylvania The parser generates a syntactic tree in the manner of a Penn ... Dekang Lin 1998 Automatic retrieval and clustering of similar words In Proceedings of the COLING-ACL'98, pages 768-773 Proceedings of EACL '99 Rila Mandala, Takenobu Tokunaga, and Hozumi Tanaka ... References J Aitchison and A Gilchrist 1987 Thesaurus Construction: A Practical Manual Aslib D.C Blair and M.E Maron 1985 An evaluation of retrieval effectiveness Communications of the ACM, 28:289-299...
- 8
- 263
- 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures
... Degradation (%) = C0 Ct A0 At u100% = u100% A0 C0 (1) where C0 and A0 are the initial concentration and absorbance of KGL, and Ct and At are the concentration and absorbance of KGL at a certain ... Chauhan, R Kumar, G Kumar, S .A Al-Sayari, S.W Hwang, A Al-Hajry, Large-scale synthesis of ZnO balls made of fluffy thin nanosheets by simple solution process: structural, optical and photocatalytic ... ºC) and ZnO (90 ºC) samples and a commercial ZnO sample It should be noted that after irradiation for 40 min, only for the ZnO (120 ºC) sample did the degree of degradation approach 100%, and accordingly...
- 26
- 551
- 0
báo cáo hóa học:" Research Article A New Angle-Based Location Method Using a Forward-Link Signal" pot
... that of RLAOA 2.1 FLAOA Measurement Model AOA location systems measure the incident angle at an array antenna Assuming that two antennas are horizontally separated by a distance d to form an array ... [14] It is also assumed that angle measurements are obtained using IR-UWB system with linear array antennas for RLAOA For FLAOA, an “L” shape planar array antenna is used to avoid angle ambiguity ... Closed-Form Solution for FLAOA Measurement RLAOA measurement is nonlinear to user position as in (2) By measurement transformation, a closed-form solution for RLAOA measurement was derived in [7] As...
- 6
- 249
- 0
Báo cáo hóa học: " Research Article A SystemC-Based Design Methodology for Digital Signal Processing Systems" potx
... algorithms automatically to an FPGA platform Compaan/Laura [18] automatically converts a Matlab loop program into a KPN network This process network can be transformed into a hardware/software system ... performance of a design point: (1) by simulation and (2) by analytical methods Simulation-based approaches permit a more detailed performance evaluation than formal analyses as the behavior and ... is, a formal model for the architecture template as well as mapping constraints for the actors of the SysteMoC application All these information are captured in a formal model to allow automatic...
- 22
- 428
- 0
báo cáo khoa học: " Lessons from the evaluation of the UK''''s NHS R&D Implementation Methods Programme" doc
... such as cardiovascular disease and mental health, and was largely clinically-focused, with an emphasis on randomised control trials (RCTs) as the gold standard research methodology In contrast, ... and what research approaches were available, in others more exploratory work was needed, and in some areas it was too early to fund anything But at the outset, it was not clear which area was which ... not for citation purposes) Implementation Science 2007, 2:7 Methods A range of quantitative and qualitative methods was used and triangulation techniques were applied Documentary analysis Analysis...
- 13
- 294
- 0
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx
... normalization method as in [19], which includes base 10 log-transformation as well as normalization to mean and variance For the data that contains negative values, we not perform log-transformation ... approach and the classifier List of abbreviations ANMM4CBR: additive nonparametric margin maximization for case-based reasoning; ANMM: additive nonparametric margin maximization; NMM: nonparametric ... contains two modules, ANMM for feature selection and CBR for classification Both ANMM and CBR are suitable for dealing with microarray data, which usually contain noisy information and only a small...
- 11
- 373
- 0
Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps
... Issue 4, Article R66 Solignac et al assemblies The simultaneous availability of genetic and physical data also provided the opportunity for mutual quality control and to reach a quasi-colinearity ... of this paper Additional data file is a PDF file containing a microsatellite-based genetic map of the honey bee, AmelMap3 Additional data file is an Excel file containing the linkage map of the ... drift) may promote an increase in recombination [17] A higher recombination rate has also been observed for farm animals compared to non-domesticated mammals [17] Increased recombination was also...
- 14
- 261
- 0
Báo cáo y học: " ngLOC: an n-gram-based Bayesian method for estimating the subcellular proteomes of eukaryote" pps
... are available with the online version of the paper Additional data file contains all of the formulas used for performance measurements and Supplementary Tables 1-21 Additional data file contains ... comparative measure of the overall performance of the classifier Finally, we show a ROC curve as a graphical means of measuring the performance for each class (All of our formulas used to measure ... subcellular locations, and are freely available for offline analysis For uniformity, we used a random selection of 80% of our dataset for training and 20% for testing The overall accuracies of...
- 17
- 258
- 0
Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf
... used AGGAAAAGGCCTTGAAGCTC and TGCTGTATTTGACAGGACAAGTG (outer primers), and GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAGGACAAGTG (inner primers) For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCTTCTCATTTAG ... paper All authors read and approved the final manuscript 10 Additional data files The following additional data are available with the online version of this paper Additional data file contains ... Clinical sample designation AA9 B421 S104 MCF-7 25-48 860-7 BT-474 SK-BR-3 Organ site Brain Breast Breast Breast cancer adenocarcinoma (metastasis pleural effusion) Prostate metastasis Ovarian carcinoma...
- 17
- 424
- 0
Báo cáo y học: " Sequence-based prediction of protein-protein interactions by means of codon usage" doc
... 16:542-549 Arifuzzaman M, Maeda M, Itoh A, Nishikata K, Takita C, Saito R, Ara T, Nakahigashi K, Huang HC, Hirai A, Tsuzuki K, Nakamura S, AltafUl-Amin M, Oshima T, Baba T, Yamamoto N, Kawamura T, IokaNakamichi ... 5, Article R87 Najafabadi and Salavati R87.7 Coevolution of CAI We performed the same analysis as described by Fraser et al [14], using the genome sequences of S cerevisiae, Saccharomyces paradoxus, ... yeast gold standard positive set Additional data file is a figure comparing the naïve Bayesian network and fully connected Bayesian network in the yeast gold standard negative set Additional data...
- 9
- 336
- 0
Báo cáo y học: " Sequence-based feature prediction and annotation of proteins" ppt
... PL, Fariselli P, Casadio R: BaCelLo: a balanced subcellular localization predictor Bioinformatics 2006, 22:e408-e416 34 Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai ... the available in vivo and in vitro data to derive probabilistic sequence models of linear motifs This type of approach is therefore automatically maintained as new data become available and represents ... SVMs, and is specific for animals, fungi and plants; TargetP [6], based on neural networks and specific for non-plants, plants and prokaryotes; WoLF PSORT [34], a classifier that computes a large...
- 6
- 187
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25