a discussion of structure and function

... medial malleolus (M) and tendo Achilles (TA) Small arrow indicates rounded TP tendon proximally and large arrow indicates the flattened area of tendon in retromalleolar region as a result of the ... JW and DET critically revised the manuscript All authors read and approved the final manuscript Additional material Additional file Posterior approach A video demonstration of the posterior approach ... Journal of Foot and Ankle Research 2009, 2:24 Figure Audit of placement of intramuscular electrode Audit of placement of intramuscular electrode Gross anatomy of dissected limb with intramuscular...

Ngày tải lên: 10/08/2014, 21:23

... investigation and understanding of their structure- activity relationships, may start to provide a rational way to develop additional pharmacological tools for the elucidation of nAChR structure and function ... subunits and a- BTX distinguished two major classes of nAChRs: a major population of a- BTX binding a7 * nAChRs which is mainly localized perisynaptically, and a less abundant population of a3 * nAChRs ... interfaces within neuronal nAChR subunit combinations (compare Fig 2A C) So far, a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI)...

Ngày tải lên: 19/02/2014, 12:20

... strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity of ... folding of the initially randomized helices with the wild type template A sequential strategy of randomizing helix first and then randomizing helices and of an active variant from the first library ... chorismate mutase by combinatorial mutagenesis and selection: the importance of electrostatic catalysis Proc Natl Acad Sci USA 93, 5043–5048 11 Haslam, E (1993) Shikimic Acid: Metabolism and Metabolites...

Ngày tải lên: 19/02/2014, 12:20

... package for the handling and analysis of thermal denaturation data of biological macromolecules J.Thermal Analysis, 39, 2779-2790 [15] Fessas D .and Schiraldi A (2001) Water properties in wheat ... industrial treatments) as for starch gelatinization, water uptake and simulation of chewing through dynamical tests Materials and Methods Medium grain Ribe rice, a type of arborio (short-grain) ... parboiled rice and the final rice-based food These changes are mainly related to physical processes, like starch gelatinization and retrogradation, leaching of amylose (up to 10% of the overall...

Ngày tải lên: 19/03/2015, 13:36

... Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, ... Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled A H A single a- helix is indicated...

Ngày tải lên: 07/03/2014, 00:20

... 5¢-CGGAACCCCGCAGGTCGAGTTTCC-3¢ and 5¢-GA CGAGGTGCTCGGGGCTCTT-3¢; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA ... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was ... 188–122) A large difference is centred on Met121 In particular, the mean B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms...

Ngày tải lên: 16/03/2014, 16:20

... oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... side chains of asparagines 82, 84, 87 and 88 and lysine 79 [14] The a- helical domain contains three major ahelical (amino acids 5–11, 23–34 and 86–98) and two short 310-helical domains The smaller ... Hospital Foundation, Royal Physiographic Society, Anna-Lisa, Sven-Erik Lundgren Foundation, Knut and Alice Wallenberg Foundation, Inga-Britt and Arne Lundbergs Foundation and the John and Augusta...

Ngày tải lên: 29/03/2014, 21:20

... chloroplast ultrastructure, and leaf characteristics of high- and low-light plants and of sun and shade leaves Photosynth Res 2, 115-141 light E.M (1986) Correlation of activity and amount of ribulose ... ultrastructure was analyzed from the electron micrographs as described by Aro et aL, (1986) and Vapaavuori (1986) On an average, typi- cal chloroplasts were analyzed sample of the replicate plots ... correla- N P and the ratio of the length of appressed to nonappressed thylakoid membranes (Fig 2A) and between the ratio of the length of appressed to non-appressed thylakoid membranes and photon...

Ngày tải lên: 09/08/2014, 03:24

... the CHD and that of the DHD Correlation 4: translation and access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, ... BFAT may also be realized within the wetware circuitry of transduction signaling pathways representative of a form of cell firmware Page 17 of 29 D’Onofrio and An Theoretical Biology and Medical ... compartmentalization of active and non active domains along the DNA as a function of epigenetic expression Structural organization within the nucleus exhibits a dynamic quasi - steady state (as...

Ngày tải lên: 13/08/2014, 16:20

... primerBT_2972: Forward: 5’CTTTCATATGCATCATCATCATCATCATAGTAACAATAATACAT’3 Reverse: 5’ CTTTCTCGAGTCATCTTTTTTGTCCTATATAGAATACGTA’3 BVU_3255: Forward: 5’ CTTTCATATGCATCATCATCATCATCATAATAATGAC ’3 Reverse: ... titrated against Ca2+/CaM; (B) R4 3A Nm titrated against 118 xiii apo CaM; (C) R3 8A Ng titrated against Ca2+/CaM; (D) R3 8A Ng titrated against apo CaM Figure 6.19: Interactions of (A) NmIQ2 and ... peptides titrated against CaM (A) NmIQ1 titrated against Ca2+/CaM; (B) NmIQ1 titration against apo CaM; (C) NgIQ1 titrated against Ca2+/CaM; (D) NgIQ1 titrated against apo CaM 109 Fig 6.16: (A) Cα superimposition...

Ngày tải lên: 10/09/2015, 08:38

... ClassII: ARF4, ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... members at the moment 12 13 human ARF1 human ARF mouse ARF2 mouse ARF2 human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 ... Arl3p, are homologues of mammalian Arl1, Arl2 and ARFRP1 respectively (Takai et al., 2001) 10 Table A comparison of the identities and divergences of the mammalian ARF and Arl subfamily of small...

Ngày tải lên: 17/09/2015, 17:20

... Gupta A, Kumar R, Cayrou C, Avvakumov N, Bhadra U, Pandita RK, Porteus MH, Chen DJ et al (2010) MOF and histone H4 acetylation at lysine 16 are critical for DNA damage response and double-strand ... these advances have been accompanied by a relative decrease in the number of studies aimed at gaining an understanding of the structural conformation of chromatin, and the changes in chromatin structure ... TG, Sharma GG, Park C, Agarwal M, Ganju RK, Pandita S, Choi K, Sukumar S, Pandita RK et al (2008) The mammalian ortholog of Drosophila MOF that acetylates histone H4 lysine 16 is essential for...

Ngày tải lên: 14/02/2014, 18:20

... (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number: 1867423; Roche Diagnostics, Basel, Switzerland) ... region of MAP2 CD2 domain (702–744 aa) in human, mouse and Gallus This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, ... fluorescent images of their dendrites were analyzed with neurolucida software (MBF Bioscience, Williston, VT, USA) Image data were statistically quantified by repeated-measures analysis of variance with...

Ngày tải lên: 14/02/2014, 19:20

... are available for some systems, such as temperate lakes and streams and the surface waters of temperate oceans, than for others, such as tropical lakes and streams and the abyssal depths of the ... Paracyanthus stearnsi1 Sansibia spp.1 Stylatula elongata1 Xenia spp.1 Actinaria (sea anemones) Anemonia viridis1 Anthopleura elegantissima Corynactis californica1 Metridium senile Zoanthidea ... the rate of turnover at steady state Data on rmax for a wide variety of organisms, from unicellular eukaryotes to invertebrates and vertebrates, have been compiled and analyzed by Savage et al...

Ngày tải lên: 17/02/2014, 19:20

... TcAP1 and TcAP2 from Theobroma cacao seeds Planta 215, 754–762 12 Park, H., Yamanaka, N., Mikkonen, A. , Kusakabe, I & Kobayashi, H (2000) Purification and characterization of aspartic proteinase ... properties and action on gliadin Planta 177, 321–326 49 Asakura, T., Watanabe, H., Abe, K & Arai, S (1997) Oryzasin as an aspartic proteinase occurring in rice seeds: purification, characterization, and ... Tormakangas, K & Ostman, A (1991) Primary structure of a barley-grain aspartic proteinase A plant aspartic proteinase resembling mammalian cathepsin D Eur J Biochem 202, 1021–1027 14 Schaller, A...

Ngày tải lên: 19/02/2014, 12:20

... the structure and dynamics of each protein, and present a comparison of sbwAFP and TmAFP with each other and with proteins that have a similar fold Structure of sbwAFP and TmAFP The structure of ... 2A) The shape is approximately that of a triangular prism, with ˚ each face being 17 · 23 A, with a total solvent accessible ˚ surface area of about 1355 A2 The three sides of the prism contain ... the addition of an additional one, two or three b-helical coils compared to the shorter isoforms In the case of one sbwAFP isoform, named CfAFP-501, a detailed examination of the structure and function...

Ngày tải lên: 19/02/2014, 16:20

... were obtained for more than 99% of the 1H, 13C and 15N atoms of the protein backbone, and for more than 78% of the side chain atoms The main set of backbone u and w dihedral angles was calculated ... stretch of C-terminal acidic amino acids of translational release factor eRF1 is a primary binding site for eRF3 of fission yeast RNA 4, 958–972 Ebihara K & Nakamura Y (1999) C-terminal interaction of ... basis of the structural data, we have performed a mutational analysis of the C-domain and investigated the impact of the mutants on stop codon recognition Results Resonance assignment H, 13C and...

Ngày tải lên: 06/03/2014, 11:20

... and most modern financial calculators If you are unable to calculate duration, consult your financial advisor 36 Assume that modified duration given the current value of the yield, maturity and ... must fall when interest rates rise, consider a Treasury bond held by an investor with a principal or par amount of $1,000, payable at maturity, and a coupon interest rate of 7% This means that the ... and must be taken into account when considering an actual trade, and when calculating actual net returns on any option transaction These charges and requirements may vary, and should be discussed...

Ngày tải lên: 06/03/2014, 14:20

... the b1-strand and b2-strand are adjacent and parallel to each other, and the b¢-strand is adjacent and antiparallel to the b1-strand (Fig 1) The length and sequence of the variable loop are different ... KH1–KH2 domains of NusA recognize RNA ligand 5¢-GAACUCAAUAG (A) The KH1–KH2 domains of NusA bound to cognate RNA ligand (Protein Data Bank entry 2ASB) The RNA–protein contact surface spans across ... order b1, b¢ and b2 The b1-strand and b2-strand are parallel to each other, and the b¢-strand is antiparallel to both (Fig 1) This all-antiparallel arrangement of strands distinguishes the type...

Ngày tải lên: 07/03/2014, 05:20

... 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC C143S C211S 5¢-GATGGCTCCGAGAGTGGCAGTGGAGGCTGGGG 5¢-CCCATTTGTATAGGGACTTTGATAAAAGTAAG C217S 5¢-GCTGGATTTAGTCAGAAAATTGCAGAAGGTG C268S 5¢-CCCATTCTGAGTGTGGGCTCAGTGTGG TGATGG ... generation of GlcNAc kinase cysteine mutants by site-directed mutagenesis Mismatches with the template are underlined Name Sequence C45S C131S 5¢-GGCACAGACCAGAGTGTGGAGAGGATCAATGAG 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC ... the salvage pathway for GlcNAc recycling J Biol Chem 277, 6333–6343 Yamada-Okabe, T., Sakamori, Y., Mio, T & Yamada-Okabe, H (2001) Identification and characterization of the genes for N-acetylglucosamine...

Ngày tải lên: 08/03/2014, 10:20