a different approach for cellular oncogene identification came from drosophila genetics

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

... (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing VZV-ORFs and functional attB-sites ... small format, ELISAs assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line development and data analysis, participated ... culture and incubated in a bacterial shaker for h at 37°C before addition of IPTG to a final concentration of mM and an additional shaking for h at 37°C The induced bacteria were pelleted after...

Ngày tải lên: 12/08/2014, 04:20

9 751 0
A proteomic approach for the identification of HCC serum biomarkers

A proteomic approach for the identification of HCC serum biomarkers

... proteomics-based approaches such as SERPA would be more suitable for the discovery of disease-associated autoantibodies from patients’ sera as compared to cDNA-based approaches such as SEREX 38 1.3 AIMS ... metastasis M Distant metastasis MX Distant metastasis cannot be accessed M0 No distant metastasis M1 Distant metastasis Table 1.2 Stage grouping of HCC Stage I Stage II Stage IIIA Stage IIIB Stage ... immunoprecipitation and the corresponding antigens are sequenced and identified (Anderson and LaBaer, 2005; Casiano et al., 2006; Hanash, 2003; Mintz et al., 2003) TAAs for prostate and ovarian cancers, amongst...

Ngày tải lên: 26/09/2015, 09:47

143 269 0
a decentralized approach for implementing identity management in cloud computing

a decentralized approach for implementing identity management in cloud computing

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous...

Ngày tải lên: 31/07/2013, 09:43

7 590 0
Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc

Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc

... planners, administrators and teachers, at the local as well as national level, can participate in and benefit from this exchange 11 Systematically monitor progress towards EFA goals and strategies at ... community, and take advantage of a skilled workforce (teachers and administrators) that is already engaged with individual and organisational partners in the local community As students become healthier, ... the Dakar Framework for Action during the World Education Forum (Dakar, 2000) are revitalising efforts to achieve Education for All In developing National Action Plans to achieve the goals and...

Ngày tải lên: 14/02/2014, 09:20

30 420 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

... uptake in HeLa cells by FACS analysis HeLa cells were incubated with increasing amounts of the rhodamine-labeled Tat peptide, as indicated in the ®gure Comparative FACS analysis of the internalization ... was proposed as the reason of this apparent increased uptake, as the rate of uptake was the same in serum-free medium [17] As already stated above, this Tat CPP peptide is able to vectorize various ... Futaki, S., Suzuki, T., Ohashi, W., Yagami, T., Tanaka, S., Ueda, K & Sugiura, Y (2001) Arginine-rich peptides An abundant source of membrane-permeable peptides having potential as carriers for...

Ngày tải lên: 21/02/2014, 03:20

8 485 0
Tài liệu Design for Sustainability a practical approach for Developing Economies doc

Tài liệu Design for Sustainability a practical approach for Developing Economies doc

... Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, ... Austria Mr Samantha Kumarasena, NCPC, Sri Lanka Mr Nguyen Hong Long, NCPC,Vietnam Ms Sophie Loran, UNEP DTIE, France Dr Diego Masera, UNEP Regional Office for Latin America and the Carribbean, ... spread as seen in the number of manuals and sectorspecific supporting materials that are available in many languages As a result, and based on experience, Ecodesign has evolved to encompass broader...

Ngày tải lên: 21/02/2014, 05:20

128 514 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... determination For immunochemical determination of subcellular localization of CatE and CatD, western blot analysis was performed No CatE was recovered from any subcellular fraction of WT100 Endosomal ... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... Gambacorta, L and Marqués-Ibañez, D (2008), "Securitisation and the bank lending channel", European Economic Review (forthcoming) [3] Altunbas, Y., Gambacorta, L and Marqués-Ibañex (2009), "Bank...

Ngày tải lên: 15/03/2014, 10:20

30 911 0
A Conceptual Approach for Cannibalism Between Goods pot

A Conceptual Approach for Cannibalism Between Goods pot

... cannibalism Thus, cannibalism may be understood as an appropriation that a new product is part or all of sales, the sales volume (quantity) of market share, the profits, the spaces intended for ... of a competing product (from another company) also creates a market expansion It is a situation of greater risk than before, considering that the new product can experience a counterattack from ... estudo exploratório dos fatores de marketing que contribuem para a sua ocorrência em indústrias alimentícias paulistanas (Dissertation: Master in Administração) Mackenzie, São Paulo (in Portuguese)...

Ngày tải lên: 16/03/2014, 11:20

5 366 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... constructed as follows The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

... are defined similarly Average precision is the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of average precision and average ... the case of a larger scale annotation effort, having the person leading the effort provide one or two examples of literal and nonliteral usages for each target verb to each annotator would almost ... feature lists SuperTags (Bangalore & Joshi, 1999) encode a great deal of syntactic information in a single tag (each tag is an elementary tree from the XTAG English Tree Adjoining Grammar) In addition...

Ngày tải lên: 24/03/2014, 03:20

8 447 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... 85(3):221-228 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... Bossolasco P, Deliliers GL: Differentiation and expansion of endothelial cells from human bone marrow CD133(+) cells Br J Haematol 2001, 115(1):186-194 Asahara T, Masuda H, Takahashi T, Kalka C, Pastore ... human bone marrow Proc Natl Acad Sci USA 2000, 97(7):3213-3218 Kawada H, Fujita J, Kinjo K, Matsuzaki Y, Tsuma M, Miyatake H, Muguruma Y, Tsuboi K, Itabashi Y, Ikeda Y, Ogawa S, Okano H, Hotta...

Ngày tải lên: 18/06/2014, 15:20

9 775 0
Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt

Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt

... of an Adaptive Mixed Reality Rehabilitation (AMRR) system for a reach and grasp action Preliminary data from a study employing the AMRR system has demonstrated the system’s ability to facilitate ... Figure displays a graphic representation synthesized from the Levin, Kleim and Wolf approach Kwakkel takes a related approach and notes that rehabilitation therapies should not seek to achieve full ... of customizable approaches to stroke rehabilitation Interactive rehabilitation also demands detailed, quantitative, real-time evaluation to reveal to the participant the state of his action network...

Ngày tải lên: 19/06/2014, 08:20

15 608 0
Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

... other hand, a small value for ν will result in a large model order This will lead to a small approximation error, at the price of high computational load for updating the model at each sensor, and ... from lack of real system deployments and available data experiments Researchers often evaluate their algorithms and protocols with model-driven data [38] Here, we consider a classical application ... however, each sensor must know the locations of the other sensors This unfortunately imposes a substantial demand for both storage and computational time, as most practical applications require a large...

Ngày tải lên: 21/06/2014, 17:20

12 532 0
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

... satisfied We subtract a small value ε from the values sx and s y (estimated geometrically from the image) as these values are already close to the true values Since sx and s y are already normalized ... gradients, and the blur parameter 6.1 Data fitting term Since, we have many observations of the same stationary object captured with a stationary camera, the data fitting term (from (3)) can be written as ... surface gradients and the albedo and also perform blind image restoration The surface gradients and the albedo are modeled as separate Markov random fields (MRFs), and a suitable regularization scheme...

Ngày tải lên: 21/06/2014, 22:20

12 379 0
Báo cáo hóa học: "A UNIFYING APPROACH FOR CERTAIN CLASS OF MAXIMAL FUNCTIONS" pot

Báo cáo hóa học: "A UNIFYING APPROACH FOR CERTAIN CLASS OF MAXIMAL FUNCTIONS" pot

... (3.5) We may assume that P does not contain |x|d+1 as one of its terms By dilation invariance, we may also assume that a = |α|=d+1 (3.6) A unifying approach for certain class of maximal functions ... Mathematical Bul[3] letin 49 (2006), no 1, 3–10 [4] A Al-Salman and A Al-Jarrah, Rough oscillatory singular integral operators II, Turkish Journal of Mathematics 27 (2003), no 4, 565–579 [5] A Al-Salman ... Littlewood-Paley, Lusin, and Marcinkiewicz, Transactions of the American Mathematical Society 88 (1958), no 2, 430–466 , Harmonic Analysis: Real-Variable Methods, Orthogonality, and Oscillatory Integrals,...

Ngày tải lên: 22/06/2014, 22:20

17 334 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identification for nonstationary signal analysis ... Krishnan, R M Rangayyan, G D Bell, and C B Frank, “Adaptive time-frequency analysis of knee joint vibroarthrographic signals for noninvasive screening of articular cartilage pathology,” IEEE Trans ... The vectors are selected from a family of waveforms called a dictionary The signal x(t) is projected onto a dictionary of TF atoms obtained by scaling, translating, and modulating a window function...

Ngày tải lên: 23/06/2014, 01:20

8 355 0
Applied Biophysics A Molecular Approach for Physical Scientis pdf

Applied Biophysics A Molecular Approach for Physical Scientis pdf

... central dogma of molecular biology considers the duplication and translation of DNA DNA is duplicated from a DNA template DNA is transcribed to form a RNA chain, and this information is translated ... chemistry: aspartate, glutamate, asparagine, and glutamine The linkages between amino acids all have the same chemistry and basic geometry (Figure 1.2) The peptide linkage that connects all amino acids ... trigger cellular activity in plant seeds, and such dehydrated cellular organisms can remain dormant for many thousands of years before being reactivated by the addition of water A wide range of...

Ngày tải lên: 27/06/2014, 10:20

436 179 1
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

... liver metastases Am J Surg 2003, 185:221-229 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge T, Sugihara K, Moriya Y: Resection for multiple metastatic liver tumors after portal embolization ... Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T: Measurement of liver volume and hepatic functional reserve as a guide to decision-making in resectional ... liver metastases may be curative when the primary disease has been eradicated and negative surgical resection margins are attained However, a large tumor burden in the hepatic parenchyma may prohibit...

Ngày tải lên: 09/08/2014, 07:21

4 455 0
w