a deterministic theory of complexity information and entropy

... novat ion A t tr ac t co m pe t ing des i gn A t tr ac t f ol l owe r Exp a nd in vest m en t A t tr ac t r ela t ed in novat ions Th r ea t en ex i st i ng in dust r y C r ea t e of ... C r ea t e of co m m u ni t ies D e st r oy ex ist ing in dust r y s t ruc t u r e I ndust r y Sh a keou t R e jec t ed des i gns D o m i nan t D e sign D om i nant D e s ign/ S tanda Yes ... &" A c t ivi ti e s Inno va ti on Cyc le T ec hnolog ACT IVI T IE S y C y cl e Pe r ce i ved oppo rt uni t y I PO I nnova t ion deve l op m en t T ech n olog ica l D is c o ntinu itie s Launc

Ngày tải lên: 11/09/2015, 21:50

... schizophrenia [1] and was conceived as an operationalized, change-sensitive instrument that offers balanced representation of positive and negative symptoms and estimates their relationship to one another ... standard error of the PANSS subscales indicate that Positive and Negative subscales operate in a similar manner and are more - 17 - discriminating than the General Psychopathology ... This is a program for data analysis from tests, scales and questionnaires. In particular, it displays the performance of items and options within items, as well as other test diagnostics and utilizes

Ngày tải lên: 11/08/2014, 16:20

... suggest a systems theory of organizational information It was a middle range theory of pragmatic information, or of information in IS, which could be applicable for various organizations and sociocultural ... Case: Lean production solutions Total: organizations Total: organizational cases and embedded units of analysis Table 4.18 The distinction among three basic patterns of organizational information ... dialectical evolution of organizational information: one, as organizational habit, it enables us to guide organizational activities; two, it indirectly enables organizational changes that are

Ngày tải lên: 10/08/2015, 11:58

... present the standard pragmatic approach to metaphor and, most importantly, various lines of criticism against this approach As an alternative theory of metaphor in a pragmatic framework, ... Thoughts and Feelings by Able Autistic, Mentally Handicapped and Normal Children and Adults. Journal of Autism and Developmental Disorders 24 12954 1995 Understanding Minds and Metaphors: Insights ... Studies of Literal and Figurative Language. Journal of Pragmatics 31 91929 2002 Literal vs Figurative Language: Different or Equal? Journal of Pragmatics 34 487506 Giora, Rachel and Ofer Fein

Ngày tải lên: 28/10/2016, 09:33

... Chair (Tier II) for Knowledge Translation in Child Health and is also supported by an Alberta Innovates Health Solutions Population Health Investigator Award Availability of data and materials ... Melbourne, Australia) qualitative data management software was used for data management during the analysis Braun & Clarke’s phases of thematic analysis were used [36] The interviewer (KS) regularly ... of Alberta Health Research Ethics Board All potential participants were identified and approached by a physician or nurse on staff when Page of 10 the first author (KS) was present and available

Ngày tải lên: 01/02/2020, 05:05

... structure and elements of the game, including the payoffs of the agents and the information they have Second is to ensure that all pathways and information sets have equal probabilities of being reached ... held research and teaching positions in Academia Sinica (Taiwan), National Taiwan University and Nanyang Technological University (Singapore) He was the recipient of Lee Foundation Scholarship ... that is based upon Bayesian rationality This new game theoretic rationality includes rationality in actions and strategies, rationality in prior and posterior beliefs and, rationality in statistical

Ngày tải lên: 15/08/2020, 10:27

... and legitimacy already will be a member of a firm's dominant coalition When such a er's claim is urgent, managers have a clear and immediate mandate to attend to and give priority to that stakeholder's ... stakeholder framework as it currently stands What is needed also is a theory of stakeholder salience that can explain to whom and to what managers actually pay attention Among the various ways of identifying ... Is a Stakeholder, and What Is a Stake? (5) taken about the existence and nature of the stake that presents an area of argument, because it is upon the basis of "stake" that "what

Ngày tải lên: 27/02/2021, 17:39

... Specifically, the explanations are analysed as follows: • Economic advantage by scale and adaptability: (i) MSEs are small in scale, thus very easy to disassemble; LEs are large in scale, thus ... LEs are difficult to adapt because large scale operations require high standards; • Management capacity: (i) MEs are more productive than MSEs, able to take advantage of economies of scale ... Jasra, J., Ahmed, I I H., Aziz, U R., Rauf, I A. , & Muhammad, A K (2011) Determinants of business success of small and medium enterprises International Journal of Business and Social

Ngày tải lên: 03/04/2021, 18:19

... 158 loss of position at Graz, 152–153 mainstream interpretation of quantum mechanics and, 119–120 as man of contradictions, 4–5 mathematics and, 17 at Naturforscherversammlung, 91 Nazis and, 127–128, ... Konenkova, Margarita, 184 Kuhn, Thomas, 219 Ladenburg, Rudolf, 135 Lagrangian formulation, 57–58, 171–172, 173 general unitary theory and, 189, 190 Lagrangians, 226–227 Landau, Jacob, 196 Large Hadron ... Michal Mayer, Faye Flam, Dave Goldberg, Mark Wolverton, Brian Siano, and Neil Gussman, is most appreciated Thanks to historians of science David C Cassidy, Diana Buchwald, Tilman Sauer, Daniel

Ngày tải lên: 01/06/2022, 08:44

... makes a human a human and create ways that take advantage of this There is a reason that Homo sapiens are the dominant species Our natural abilities are many and tailor-made to dominate our environment ... understand how much data we generate At best we can claim that we are archiving data for analysis later At worst we must realize that we do not have a reason to collect the clear majority of data ... industrial age Data is the raw material of the information age.”9 We stand at the crossroads of the industrial age and the information age; thus, it bears looking at the change from agricultural age to

Ngày tải lên: 03/05/2024, 06:54

... is used to analyse and evaluate the performance of a planar and a tubular-shaped PEM fuel cell 2.1 Computational domain The full computational domains for the planar and tubular-shaped PEM fuel ... is change for planar shape, where under the land areas a noticeable decrease takes place It can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer ... the major transport phenomena such as convective and diffusive heat and mass transfer, electrode kinetics, transport and phase-change mechanism of water, and potential fields in a tubular-shaped

Ngày tải lên: 05/09/2013, 14:58

... first newspaper of which St. Louis can boast, and I am told it still has the largest circulation of any paper west of the Alleghany Mountains. As regards the character of your great-grandfather, he was ... that “grandpa” was just such a boy as you are–-fond of fun and frolic, and of playing tricks. I have said nothing of his love of school and books. But I think he was about as fond of both as ... a nice sofa, (bought at auction, because it was cheap), and that at another time a small side-board... we started, in fine style, on a beautiful morning "grandpa," and "grandma," our

Ngày tải lên: 23/03/2014, 05:20

... Cys35Ala R-TDPX1 Cys35Ala F-TDPX1 Cys64Ala R-TDPX1 Cys64Ala F-TDPX1 Cys83Ala R-TDPX1 Cys83Ala TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ... ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTG GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTC GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACC ... GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACC AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAG CTCAGCCTTGAAACGCGTGGCGGCGAAACTTTTCACCT 5654 FEBS Journal 274 (2007) 5643–5658 ª 2007 The Authors Journal compilation ê

Ngày tải lên: 23/03/2014, 07:20

... works that the artist himself was aware of. Often paintings contain homages to earlier artists and this concept of homage fits what we have said about caricature: the later artist makes a caricature ... Ramachandran and William Hirstein The Science of Art A Neurological Theory of Aesthetic Experience We present a theory of human artistic experience and the neural mechanisms that mediate it. Any ... the artist to abstract the ‘essential features’ of an image and discard redundant information is essentially iden - tical to what the visual areas themselves have evolved to do. 17 V.S. RAMACHANDRAN

Ngày tải lên: 23/03/2014, 13:20

... stand-alone and interactive computation. All at the same time, we can have variables whose initial and final values are all that is of interest, variables whose values are continuously of interest, variables ... B ,A symmetry 15 2 Basic Data Structures A, (B,C) = (A, B),C A A = A A? ??B = B A A? ??(B‘C) = (A B)‘C A, B: C = A: C ∧ B: C A: B‘C = A: B ∧ A: C A: A, B A B: A A: A A: B ∧ B: A ... translate informal descriptions to formal ones A statement in a natural language can... explanation that the variables are x and y , and that their domain is int The example illustrates that

Ngày tải lên: 29/03/2014, 16:20

... sexual materials on the Internet? Some have portrayed the Internet as awash in sexual material and contact with it virtually unavoidable (Elmer- DeWitt, 1995). Others portray the sexual material ... other races including American Indian, Alaska Native, Asian, and Hispanic White. Twenty percent of youth lived in a single-parent household. Nearly half (46%) lived in households with an annual income ... or separated, and/ or a parent losing a job), from the physical and sexual assault items on a victimization scale, and from a depression scale (five or more depression symptoms in the past month).

Ngày tải lên: 29/03/2014, 19:20

... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, ... Murata3, Madoka Ishikawa3, Chun R Lim3, Takumi Teratani1, Izuho Hatada4, Kenichi Matsubara3, Takashi Kato2 and Takahiro Ochiya1,2 Section for Studies on Metastasis, National Cancer Center Research ... A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells Yusuke Yamamoto1,2,*, Agnieszka Banas1,*, Shigenori Murata3,

Ngày tải lên: 30/03/2014, 04:20

... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... hypoxia and reoxygenation phases, typical of intermittent hypoxia, also stabilize HIF- 1a and activate HIF-1? In the absence of oxygen, HIF- 1a is rapidly stabilized, and short, intermittent hypoxia

Ngày tải lên: 30/03/2014, 04:20

... use and language learning, and is therefore of great importance to language teachers. Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while ... clause) is a group of words that has a subject and a verb. As it is a part of a sentence but grammatically independent, it could stand alone as a main clause. The writer try to take full advantage ... General Assembly proclaims this universal declaration of human rights as a common standard of achievement for all peoples and all nations…(last phrase of the Preamble). + The purposes, basis...

Ngày tải lên: 07/11/2012, 14:17

... (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take measures to encourage regular attendance at schools and the reduction of drop-out ... pornographic performances and materials. Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic ... from all forms of sexual exploitation and sexual abuse. For these purposes, States Parties shall in particular take all appropriate national, bilateral and multilateral measures to prevent: (a) ...

Ngày tải lên: 07/11/2012, 14:17