... be treated as a weak perturbation to a primarily linear problem As waves approach shore, wave height increases due to the effect of shoaling, and wave breaking occurs on most gentle natural slopes ... face of a wave moves at a slower speed than the wave crest, causing the overturning motion of the wave crest Such an overturning motion usually creates a jet of water, which falls near the base ... Freilich and Guza 1984) Although standard Boussinesq models can predict wave transformation in coastal regions with relative accuracy, its range of validity is limited to fairly shallow water (McCowan,...
Ngày tải lên: 04/10/2015, 15:52
... denotes a statistical average value at the moment t, and ψ t = T r(W being the density matrix operator) Starting from the Hamiltonian in Eq (1) and using the commutative relations of the creation and ... the case of the absence of laser radiation 130 NGUYEN THI THANH NHAN, LE THI LUYEN, NGUYEN VU NHAN, NGUYEN QUANG BAU IV CONCLUSION In this paper, we analytically investigated influence of laser ... Then, we estimate numerical values for the specific nGaAs/p-GaAs DSL to clarify our results II THE ABSORPTION COEFFICIENT OF A WEAK EMW IN THE PRESENCE OF LASER RADIATION FIELD IN A DSL II.1 The...
Ngày tải lên: 30/10/2015, 20:52
IMPACT OF THE EXTERNAL MAGNETIC FIELD AND THE CONFINEMENT OF PHONONS ON THE NONLINEAR ABSORPTION COEFFICIENT OF a STRONG ELECTROMAGNETIC WAVE BY CONFINED ELECTRONS IN COMPOSITIONAL SUPERLATTICES
... field has one main maximum and several neighboring secondary maxima The further away from the main maximum, the secondary one is the smaller But in the case of absence of an external magnetic ... specific of the GaAs − Al0.3 Ga0.7 As compositional superlattices II CALCULATIONS OF THE NONLINEAR ABSORPTION COEFFICIENT OF A STRONG ELECTROMAGNETIC WAVE BY CONFINED ELECTRONS IN A COMPOSITIONAL SUPERLATTICE ... low-dimensional systems are obtained The analytical expressions are numerically calculated and discussed to show the differences in comparison with the case of absence of an external magnetic with a specific...
Ngày tải lên: 31/10/2015, 10:40
ON THE HALL EFFECT IN PARABOLIC QUANTUM WELLS WITH AN IN PLANE MAGNETIC FIELD IN THE PRESENCE OF a STRONG ELECTROMAGNETIC WAVE (LASER RADIATION)
... the Landau levels The analytical result is numerically evaluated and graphed for a specific quantum well, GaAs/AlGaAs, to show clearly the dependence of the Hall coefficient on above parameters ... dominant at low temperatures and electron gas is then degenerate We derive analytical expressions for the electrical conductivity tensor and the Hall coefficient (HC) taking account of arbitrary transitions ... and |N ′ , kx + q⊥ > are electron states before and after scattering; ωq is the energy of an acoustic phonon with the wave vector q = (q⊥ , qz ); a+ N,kx and aN,kx (b+ q and bq ) are the creation...
Ngày tải lên: 31/10/2015, 10:41
The Nonlinear Absorption of a Strong Electromagnetic Wave in Lowdimensional Systems
... are carried out with a AlAs/GaAs/AlAs quantum well, a compensated n-p n-GaAs/p-GaAs doped superlattices, a specific GaAs/GaAsAl quantum wire This book chapter is organized as follows: In section ... superlattice, a Ga As/Ga As Al cylindrical quantum wire and a a Ga As/Ga As Al rectangular quantum wire show that α depends strongly and nonlinearly on the intensity E0 and the frequency Ω of the ... values of the radius of wire It is seen that α has the same maximum values (peaks) at Ω ≡ ω The electromagnetic wave energy at which α has a maximum are not changed as the radius of wire is varied...
Ngày tải lên: 22/11/2015, 20:01
A Knowledgeable Model: Network of C-Objects
... where A3 f 2→ A4 f 3→ A5 f 4→ O2 A6 → A7 A0 = A = {O1 .a , O1 .A} , A1 = {O1 .a , O1 .A, O2 .A} , A2 = { O1 .a , O1 .A, O2 .A, O1.b, O1.c }, A3 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a} , A4 = ... F ∪ O Put A0 = A, A1 = t1 (A0 ), , Am = tm(Am-1), and D (A) = Am, we have A0 ⊆ A1 ⊆ ⊆ Am = D (A) ⊆ M A problem A → B on a network (O,F) is called solvable if and only if there is a sequence ... = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a} , A5 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a, O2.b}, A6 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a, O2.b, O2.c}, A7 = {O1 .a , O1 .A, O2 .A, O1.b,...
Ngày tải lên: 18/09/2012, 10:13
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
... conception and design, acquisition of data and data analysis, and the drafting, revising, and final approval of the manuscript SS was involved in the study conception and design, data analysis, and ... reporting of data following major trauma [6] Raw values presented as continuous data are of course preferable when obtainable [6] High-quality core data are imperative for quality assessment and improvement ... times Alarm at EMCC Ground/Air ambulance departure from station YN YN Ground/Air ambulance arrival on scene YN Ground/Air ambulance departure from scene YN Ground/Air ambulance arrival at destination...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are presented as absolute and relative frequencies, continuous variables as median with ... Kawagoe T, Shimatani Y, Kurisu S, Hata T, Nakama Y, Kijima Y, Kagawa E: Is admission hyperglycaemia in non-diabetic patients with acute myocardial infarction a surrogate for previously undiagnosed ... usual criteria [25] Acute coronary syndrome, unstable angina and myocardial infarction were defined according to the ACC/AHA criteria [26,27] Statistical analyses MedCalc™ v 9.6.2.0 (MedCalc Software,...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"
... health insurance companies in Germany Nearly 90% of the 82 million German inhabitants are members of a statutory health insurance company Although many such companies are quite small and represent ... methylphenidate in Spain An estimation of the prevalence of attention deficit hyperactivity disorder Revista de Neurologia 2003, 37:806-810 Andretta M, Ciuna A, Corbari L, Cipriani A, Barbui C: Impact of ... information on reimbursement patterns 5) Access to medical specialists differs 6) The US data were based on the s-CHIP Medicaid data from one state and have limitations as a representative US dataset,...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... intensive care unit JAMA 1999, 282:267-270 British Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition London; 2003 National Coordinating ... Dean BS, Barber ND: A validated, reliable method of scoring the severity of medication errors Am J Health Syst Pharm 1999, 56:57-62 Dean B, Barber N: Validity and reliability of observational methods ... involved in critically revising the draft JG made substantial contributions to the data analysis GB was substantially involved in the analysis, interpretation and drafting the manuscript Acknowledgements...
Ngày tải lên: 25/10/2012, 10:39
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... data, some of the explanation may be attributed to what appears to be optimal levels of vitamin D3 (1,000 IU) and calcium (750 mg) that were in the Plan version of AC An additional benefit may ... had an average age of 57.4 (41-89) which is consistent with the age-related decline of 1% to 2% cited above for women of menopausal age as well as with the data reported in the meta-analysis As ... benefit may be attributed to the use of a plant-sourced form of calcium that, as discussed above, appears to be more bio-available than more traditional forms of calcium Additionally, there are studies...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... motor cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, ... emotional well-being, is defined as the balance between pleasant affect and unpleasant affect (30) Life satisfaction included satisfaction of occupation, marriage and life in general, and emotional ... Mahatma Gandhi Mission’s Medical College) • Dr Swati Mahajan (Associate Professor, Community Medicine, Mahatma Gandhi Mission’s Medical College) • Dr Ashfaque Ansari (Lecturer, Ear Nose Throat,...
Ngày tải lên: 26/10/2012, 09:57
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
Ngày tải lên: 26/10/2012, 10:04
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
... the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... such as COP control, is normal then a deviation away from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns ... original data can be considered appropriate Recently Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension...
Ngày tải lên: 03/11/2012, 10:09
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... means of the Morris analysis, as in this chapter Examples of the decision variables in RaMCo are the number of fish blasts, the total capacity of urban wastewater treatment plants, and the total ... 1.2.3 Integrated management and policy analysis Integrated management Rapid changes of objectives and methodological approaches towards the management of natural resources and environment can be observed ... like a river or an estuary to a complete water system such as a river basin or a coastal area These changes result in integrated coastal-zone management, integrated river basin management and/or...
Ngày tải lên: 06/11/2012, 10:35
A critical discourse analysis of the news on north korean missile launches part 3
... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities in Nhan Dan Table ... Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...
Ngày tải lên: 07/11/2012, 14:39
A critical discourse analysis of the news on north korean missile launches part 4
... particularly associated with Michael Halliday (Halliday 1978, 1994), is an approach to language that views language in its social context, as an instrument of social interaction, rather than a ... third aspect of the meaning of the clause: clause as a representation Since the analysis of the headlines aims at investigating VOA and Nhan Dan’s representation of North Korea and the US- Japan ... interconnected metafunctions of language (the ideational, interpersonal and textual) which language in use simultaneously performs, and (ii) Halliday’s view of language as a ‘social act’ CDA has established...
Ngày tải lên: 07/11/2012, 14:39
A critical discourse analysis of the news on north korean missile launches part 5
... long-range 23 VOA9 Japan urges UN sanctions against North Korea VOA18 Japan, China, South Korea, ASEAN urge North Korea to talk The verbal process ‘urge’ strongly indicates that the US and Japan are ... Wang Oshima said…, called…, said “” Guangya calls…, but A ministry official Washington's U.N Ambassador suggests…, said “” said… John Bolton says…, said “” Russia's U.N Ambassador Churkin Vitaly ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan The analysis of lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s...
Ngày tải lên: 07/11/2012, 14:39