a critical tool in the neuro icu

... When these small RNAs are generated from doublestranded RNA, they are known as small interfering RNAs (siRNAs); however, if these small RNAs are produced from within the cell as natural RNAs that ... that some of the mammalian virus-encoded proteins, such as influenza viral protein NS1 and vaccinia viral protein E3L, have a negative regulatory role on RNA silencing in both plant and insect cells, ... providing circumstantial evidence to illustrate the potential involvement of RNA silencing of these mammalian viral proteins in their natural vertebrate target hosts [9-11] Others have shown that the...

Ngày tải lên: 13/08/2014, 09:21

... matrix of pair-wise comparisons A = (aij) can be established as follows: A1 A2 An A1 a1 /a1 a1 /a2 a1 /an A2 a2 /a1 a2 /a2 a2 /an An an /a1 an /a2 an/an 149 where ai/aj = aj/ai for all i, ... parking area development (to minimise the adverse affects of on-grade parking areas) Quality of parking area development Parking areas are in multi-storey carpark surrounded with some landscaping, ... cross-ventilated areas, the index of the distance from the window line and ratio of openable window area or other controllable openings to net primary area: 0.13 The number in benchmark is calculated...

Ngày tải lên: 16/09/2015, 08:29

... percentage of greenery area in the site In daylight factor, other constituting components in the measurement include the total area and reflectance of interior surfaces, the total area and average ... visual angles of sky at windows This can be achieved as a result of design strategies in articulating estate layout that allows windows facing to larger open spaces, rather than to narrow the spaces ... being the third lowest among the scores of all case studies This is due to the large surface parking area, resulting in small percentage of greenery area in the total site area, and the rather...

Ngày tải lên: 16/09/2015, 08:29

... is intended to indicate the future potential sustainable performance of the project, based on the information available at the end of the Design phase Because the information available during the ... sustainable public housing in Singapore In substantiating the main discourse of environmental performance and sustainable architecture, the thesis has revealed numerous negative as well as positive ... have time to integrate the new practice into their established ways of designing (Hagan, 2003) The Integrated Framework encourages and facilitates architectural students to engage in a truly interdisciplinary...

Ngày tải lên: 16/09/2015, 08:29

... was established in 1998 marked by International Sustainable Building Conference in Canada The objective of GBC is not a commercial tool, but rather a research and testing tool acting as a generic ... performances of a building as an illustration In a scenario that the building is located in tranquil site, the building can adopt a permeable design with ample and large openings, allowing the user ... effects have also been acknowledged as an inevitable factor (Dorf, 2001) Similarly, the techno-centric approach has many contributions as an initiating and radical approach, but also has drawbacks...

Ngày tải lên: 16/09/2015, 08:29

... manuscript GR carried out the interrater reliability measurements All authors read and approved the final manuscript 11 12 13 Additional files The following Additional files are available online: ... such as the training video and the Harvard CAMICU flow sheet We appointed 'delirium key-nurses', who received supplementary training, for further instruction and introduction of the CAM -ICU in their ... this information, we used the facilitators of our organization and integrated the CAM -ICU in our patient data management system Although it took some time to develop the integrated CAM -ICU, it was...

Ngày tải lên: 13/08/2014, 18:22

... service in maintaining the theory of rowing being injurious to the health At the same time I have never doubted that his early death, at the age of twenty-nine, was due to boatracing No other member ... feel certain that the Putney race alone would not have brought on the, inflammation that ensued C was a man who had never had any rest from hard training and racing for at least two years previous ... on board the " London" in the Bay of Biscay, another was drowned in swimming a young horse across a river in Australia, another was murdered by poachers, and another accidentally shot Turning...

Ngày tải lên: 14/02/2014, 21:20

... of radical intermediates that rearrange at a rate faster than that of the recombination step [16,93] Despite the apparent predominance of the hydrogen transfer mechanism as the initial step in ... J.N., Corina, D & Akhtar, M (1996) The mechanism of the acyl-carbon bond cleavage reaction catalyzed by recombinant sterol 1 4a- demethylase of Candida albicans (other names are: lanosterol 1 4a- demethylase, ... dependent The proposed mechanistic scheme has a certain intellectual attraction in satisfactorily explaining controversial P450 data [311,325], especially those pertaining to the unusually high rates...

Ngày tải lên: 19/02/2014, 16:20

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... immunoprecipitated (IP) with antiserum against the HA-epitope as indicated After translation, half of the sample was irradiated with UV-light to induce crosslinking and half was kept in the dark Crosslinked...

Ngày tải lên: 07/03/2014, 16:20

... organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay ... individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories In addition, to minimize ... findings and initial harmonization guidelines [7] Representative dot plots from all participating labs will be made available upon request Data Analysis and Interpretation Data generated by individual...

Ngày tải lên: 18/06/2014, 22:20

... organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay ... individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories In addition, to minimize ... findings and initial harmonization guidelines [7] Representative dot plots from all participating labs will be made available upon request Data Analysis and Interpretation Data generated by individual...

Ngày tải lên: 20/06/2014, 04:20

... in the parametrial areas [35], whereas Levenback found 9% of the sentinel nodes in the paraaortic area, 11% in the common iliac, 71% in the external iliac, and 9% in the parametrial area in a ... Although majority of the nodes are located in internal iliac and external iliac areas, nodes have been found in also presacral, parametrial and pararectal areas [33] In a sentinel node study carried ... cases, 90% are squamous cell carcinomas, while the rest are melanoma, adenocarcinoma, basal cell carcinoma and sarcoma [7] Nodal metastasis in vulva cancer is the main prognostic factor, irrespective...

Ngày tải lên: 09/08/2014, 07:21

... in the organization The individuals participating in these studies may have been exposed to other quality initiatives or messages All five studies are also similar in that they did not engage any ... and Quintana record consultant's Lean training program included Six Sigma instruction [33], and others noted how more than one transformative strategies was already in place within their organizations ... complete packages, as that is how they are currently proposed to healthcare organizations Health systems are continually innovating Required are transformational changes that fundamentally alter practices...

Ngày tải lên: 11/08/2014, 05:21

... Determinants of practice are the factors that affect practice patterns and explain the variation in the effectiveness of different QI interventions in changing practice patterns; they are usually ... relevant clinical practice guidelines (Clinical Practice Guidelines) It also discusses the why, what and how of measuring baseline performance defined as the measurement of actual clinical practice ... efficiently Critically appraise clinical guidelines Measure baseline performance (defined as the measurement of actual clinical practice and its comparison to desired clinical practice) Identify determinants...

Ngày tải lên: 11/08/2014, 05:22

... in the organization The individuals participating in these studies may have been exposed to other quality initiatives or messages All five studies are also similar in that they did not engage any ... and Quintana record consultant's Lean training program included Six Sigma instruction [33], and others noted how more than one transformative strategies was already in place within their organizations ... complete packages, as that is how they are currently proposed to healthcare organizations Health systems are continually innovating Required are transformational changes that fundamentally alter practices...

Ngày tải lên: 11/08/2014, 16:20

... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, the ... one of the greatest advances in critical care medicine during the past decade Similarly, recent technology has also enhanced the quality of basic CPR For the past four decades, basic CPR has been ... capable of delivering life-saving critical care Considering that sudden cardiac death due to ventricular fibrillation is one of the greatest causes of premature mortality in many societies, the...

Ngày tải lên: 12/08/2014, 23:21

... CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT ... CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The...

Ngày tải lên: 13/08/2014, 01:20

... with American clinical practice, in that a continuum of care approach for AKI (that is, matching the appropriate therapy to the patient’s clinical status at different time points) was utilized In ... both a predominantly male patient population and late renal replacement therapy initiation, may have contributed to the higher APACHE II score Finally, additional evidence supporting the overall ... finding and the investigators should be congratulated for their efforts Nevertheless, because of the landmark nature of the trial, a critical analysis is certainly in order The purpose of the present...

Ngày tải lên: 13/08/2014, 11:22

... March 2010 Page of References Du B, Xi X, Chen D, Peng J; on behalf of China Critical Care Clinical Trial Group (CCCCTG): Clinical review: Critical care medicine in china mainland Crit Care 2010, ... resulting from acute illness or injury, acute care surely should have a place in the curriculum Competing interests The author declares that he has no competing interests Published: 11 March 2010 ... Gomersall Critical Care 2010, 14:131 http://ccforum.com/content/14/2/131 that we cannot help As acute care specialists we can contribute to education in acute care as well as intensive care Initiatives...

Ngày tải lên: 13/08/2014, 20:21

Ngày tải lên: 24/11/2014, 20:39