a continual component of the hrm process
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
Ngày tải lên :
31/03/2014, 01:20
... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism ... activity, in the absence of inactiva- tion of phosphorylase, causes a large activation of glycogen synthase but a small stimulation of glycogen synthesis; (c) that the stimulation of glycogen synthesis ... by inactivation of phosphorylase is associated with both activation and translocation of glycogen synthase, and that the former mechanism alone cannot explain the stimulation of glycogen synthesis...
- 9
- 381
- 0
Báo cáo y học: "Urokinase, a constitutive component of the inflamed synovial fluid, induces arthritis" pps
Ngày tải lên :
09/08/2014, 01:21
... forms of the uPA Cleavage of the HMW-uPA is performed by several proteases including MMPs and plasmin, resulting in the release of the LMWuPA molecule, and may serve as a feedback mechanism of the ... degradation of the extracellular matrix and the regulation of angiogenesis [12,15] The clinical relevance of MMPs and plasminogen in joint inflammation is based on the studies of the synovial fluid and ... Histopathological appearance of arthritis after intra-articular injection of low molecular weight urokinase plasminogen activator (LMW-uPA) (a) Arthritic knee joint days after the LMW-uPA injection...
- 9
- 371
- 0
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx
Ngày tải lên :
11/08/2014, 11:21
... phenotypes, and acts antagonistically to suppress ABA-mediated responses As ABA is a central regulator of plant adaptation to drought [30,31] and plays a crucial role in the regulation of transpirational ... Fujita M, Oono Y, Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression profiles of ... measuring the amount of MDA, a decomposition product of the oxidation of polyunsaturated fatty acids The malondialdehyde (MDA) content was determined by the reaction of thiobarbituric acid (TBA), as...
- 14
- 254
- 0
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
Ngày tải lên :
16/03/2014, 13:20
... chemical baselines Cpex, expression of the partial heat capacity of the protein relative to the heat capacity of the protein in the native state the monomerization of the dimer), and the latter process ... for the putative mechanism of domain-swapping dimerization of RNase A and the human pancreatic ribonuclease variant, PM8 For RNase A (A) , the protein is subjected to conditions that favour the ... the same conditions as the sample and by subtracting the chemical baseline using the method of Takahashi & Sturtevant [33] Enzymatic activity measurements Assessment of the extent of the domain-swapping...
- 11
- 411
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx
Ngày tải lên :
23/03/2014, 21:21
... that OprM may be a gated channel To date, many gated channels have been reported and the calcium-activated potassium channel from rat adrenal chromaffin cells is one of them Solaro et al [36] have ... of amino acids, peptides and saccharides More importantly, the protease treatment allowed the diffusion of cephalexin and cephaloridine through the OprM channel All these data indicate that the ... b-octylglucoside, and then dialysed against a large excess of deionized water at °C overnight The liposome suspension was transferred to a glass tube, dried under an N2 gas stream, and retained in an evacuated...
- 8
- 317
- 0
BUSINESS CYCLES: A Theoretical, Historical and Statistical Analysis of the Capitalist Process potx
Ngày tải lên :
29/03/2014, 19:20
... that its subject matter is a cosmos and not a chaos It is the rationale of the idea of variables that not vary, the justification of the schema of a stationary economic process The values of ... results approach those of the WalrasEdgeworth schema It is incessant change in the data of the situations, rather than the inadequacy of the data of any given situation, which creates what looks ... swings of fifteen to twenty years—was still at an early stage Since then a large amount of statistical and a small amount of analytical work has gone forward Those who have made the principal efforts...
- 385
- 416
- 0
Báo cáo khoa học: A pH-dependent conformational change in EspA, a component of the Escherichia coli O157:H7 type III secretion system potx
Ngày tải lên :
30/03/2014, 16:20
... species, then a plot of the natural logarithm of the protein absorption at 280 nm [ln (A2 80)] vs the square of the radial distance (r2) shows a linear T Kato et al correlation between ln (A2 80) and ... is the only the probable and most conventional method to estimate Cm values without any bias The details in the analysis and the parameters for unfolding are available as supplementary material ... T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M & Shinagawa H (2001) Complete genome sequence of enterohemorrhagic Escherichia coli O157: H7 and...
- 11
- 475
- 0
báo cáo hóa học:" A comprehensive systematic review of the development process of 104 patient-reported outcomes (PROs) for physical activity in chronically ill and elderly people" pptx
Ngày tải lên :
20/06/2014, 15:20
... and adaptation 1.9% Adaptation and literature (systematic search) 1% Adaptation and experts 1% Patients and adaptation and literature (unsystematic search) 1% Patients and experts and adaptation ... Lurie A, Bean K, Mesbah M, Venot A, Strauch G, Grandordy BM, Chwalow J: The Asthma Impact Record (AIR) index: a rating scale to evaluate the quality of life of asthmatic patients in France European ... extracted the relevant data AF conducted the statistical analysis AF and MP drafted the manuscript All authors contributed to revising the manuscript and approved the final version Authors' information...
- 47
- 407
- 0
báo cáo khoa học: "Does accreditation stimulate change? A study of the impact of the accreditation process on Canadian healthcare organizations" docx
Ngày tải lên :
10/08/2014, 10:22
... for Quality in Health Care [20], Accreditation Canada is a national, non-profit, independent organization that was created in 1958 to help guarantee that healthcare organizations across Canada furnish ... new organization The RHA was a large organization composed of a number of facilities spread over a wide geographical area The accreditation process also proved to be a means for the RHA to involve ... Lemieux-Charles L, Champagne F, Angus D, Contandriopoulos AP, Paccioni A: The Impact of the CCHSA Accreditation Process on Canadian Hospitals Through Dynamic Change and the Implementation of Quality Assurance...
- 14
- 351
- 0
báo cáo khoa học: " A comparative evaluation of the process of developing and implementing an emergency department HIV testing program" pps
Ngày tải lên :
10/08/2014, 10:23
... summarize the data as a group (indexing) Together the team created tables of the data associated with the codes deemed most relevant (charting) The final phase involved comparing and contrasting the ... (S.W.), and K01 MH074369 (T.L.) The authors would like to thank Kama Brockman at the California Office of AIDS and the participants of this study Author details San Francisco General Hospital HIV/AIDS ... linkage to care as a primary responsibility of the ED testing program rather than that of HIV providers Programs that took a nontargeted approach to testing - i.e., the parallel and provider-parallel...
- 9
- 320
- 0
báo cáo khoa học:" Validation of the Excited Component of the Positive and Negative Syndrome Scale (PANSSEC) in a naturalistic sample of 278 patients with acute psychosis and agitation in a psychiatric emergency room" ppsx
Ngày tải lên :
12/08/2014, 01:22
... specifically measures aggression rather than allowing for a global assessment of the psychiatric state of patients Most of the studies that have explored the factorial of the PANSS are based on data coming ... la Gandara J, Perez V: A naturalistic multicenter study of intramuscular olanzapine in the treatment of acutely agitated manic or schizophrenic patients European Psychiatry: the Journal of the ... (CGI-I) and the Agitation and Calmness Evaluation Scale (ACES), in an unselected sample of 278 patients who received oral psychopharmacological treatment according to standard clinical practice at...
- 11
- 423
- 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps
Ngày tải lên :
12/08/2014, 20:20
... in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration of therapy Steroid therapy causes ... steroids have been used in the treatment of SARS based on the hypothesis that disease manifestations are in part due to the host’s inflammatory response Many questions regarding the use of steroids ... the basis of the pathophysiology of SARS The severe respiratory failure, which occurs in the later phase of SARS and results in critical illness, appears to be due to an excessive inflammatory...
- 3
- 355
- 0
Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx
Ngày tải lên :
13/08/2014, 19:20
... 5'-AAGTGCAGAGTTCGATTCTGTACAA-3' Probe: 5'-CGGGTCACTGGGCGTCCACC-3' Reverse: 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' ... 5'-GGATGGAGCTCGTCCAAGTG-3' Forward: 5'-GCCATCCTGACTATTTCACTGAAGA-3' Probe: 5'-AAGCCTACTTTTTCTCAAGGGCAGTCACCG-3' Reverse: 5'-GGGATGTACCCTTTTTTCTGAGAGT-3' Forward: 5'-TGTAGATTTTATCAGACTGAAGAGCTACTGT-3' ... Reverse: 5'-TGCATCAGAGGGACGAAGAAA-3' Forward: 5'-TCCGAGCAGAAATCCAATCG-3' Probe: 5'-TTGGGACACATCCCGGGCACC-3' Reverse: ocOATP1C1 [GenBank:EF420875] 5'-CTTGACGCCTACAAACA-3' Reverse: ocMCT10 [Genbank:EF489851]...
- 10
- 378
- 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
Ngày tải lên :
14/08/2014, 08:20
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors reviewed...
- 30
- 369
- 0
A study of the polishing process of a turbine blade for automation
Ngày tải lên :
26/09/2015, 10:13
... Data The position data gathered from the Polaris is in millimeters The units are already acceptable but similar to that of the original orientation data, the gathered data is the position of the ... data Section 4.4 Data Gathered The data gathered from this part of the experiments are again raw data The numbers are in millimeters for the position data and in degrees for the orientation data ... for the bus, the data is written at an address bytes away from the base address The receiver card then puts this data to the address that was given to the base address void wrtdata (int baseadd,...
- 117
- 208
- 0
Qualitative (Flow Pattern) and QuantitativeComputation of the Filling Process of a Mold(Simulation Models)
Ngày tải lên :
13/10/2016, 22:33
... gate This means that, above all, a flow path close to the wall remains there At the point of branching, the core material penetrates against the opposite wall and lingers there afterwards (Figure ... holding-pressure phase has almost no effect in the gate area The material rapidly attains the mold temperature in the (usually) small cross-section of the gate anyway and, with this, the maximum curing ... curves in the pseudoplastic range for —> 00 (Figure 5.75) This Carreau model has the advantage that it correctly reflects the actual material behavior over a broader shear-rate range than that afforded...
- 40
- 608
- 0
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM
Ngày tải lên :
23/04/2013, 10:29
... examining the costing plan for a two-layer jacket (Appendix 5, Table 2) After calculating manufacturing cost, 10% of profit rate is added then 10% of VAT (value-added tax) and another 10% retail ... sustain this advantage to maintain high profit rate over a number of years This definition uses profit rate as a measurement to rate the competitive advantage In other view, we can say that a product ... production capacity and company address Company participates frequently in trade fairs, which are organized frequently over the course of a year, especially in fashion fair and new year fair Thaloga also...
- 75
- 920
- 4