a common embryonic stem cell and cancer cell marker
Báo cáo y học: "A mouse embryonic stem cell bank for inducible overexpression of human chromosome 21 genes." ppsx
Ngày tải lên :
09/08/2014, 20:22
... using a more sensitive statistical method than the standard t-test approach The method we selected was Bayesian analysis of variance for microarrays [27-29], a Bayesian spike and slab hierarchical ... 27 BAMarray 3.0 [http://www.bamarray.com/] 28 Ishwaran H, Rao JS: Spike and slab gene selection for multigroup microarray data J Am Stat Assoc 2005, 100:764-780 29 Ishwaran H, Rao JS, Kogalur ... muscle and heart 3.05 2.2 3078 Apoe Apolipoprotein E 3.28 0.8 Only two gene/protein pairs, apoE and Sept1, showed bifurcated regulation in protein and microarray assays Materials and methods Cell...
- 18
- 460
- 0
A human embryonic stem cell based model of trophoblast formation
Ngày tải lên :
11/09/2015, 16:07
... (Carosella et al., 200 8a; Carosella et al., 2008b) Trophoblast cells are also able to avoid maternal natural killer cell monitoring and attacking independent of HLA class I expression (Avril et al., 1999) ... (Richardson et al., 2000) and to the GH1 promoter in human (Courtois et al., 1990; Imagawa et al., 1987) GATA binding protein (Gata2) and Gata3 are expressed in mouse trophoblast giant cells ... ES cells Mouse placentas lacking either Gata2 or Gata3 show reduced expression of placental hormone lactogen I and the angiogenic hormone proliferin (Ma et al., 1997) In addition, human GATA2 and...
- 205
- 261
- 0
Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx
Ngày tải lên :
07/03/2014, 00:20
... (PTB) and its neural homologue (brPTB) in prenatal and postnatal mouse brain Mech Dev 101, 217–220 Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M & Yamanaka ... room temperature Cell cycle analysis was carried out using a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ, USA) and flowjo software (TreeStar, Ashland, OR, USA) Mice and teratoma formation C57BL ... Japan) Proliferation assay, apoptosis assay, and AP staining For the proliferation assay, · 105 cells were seeded in growth medium and counted every day over days of culture Viable and total cells...
- 11
- 454
- 0
Báo cáo y học: "A comparative analysis of DNA methylation across human embryonic stem cell lines" docx
Ngày tải lên :
09/08/2014, 23:20
... To be called a SNP, a locus had to have a coverage of at least eight reads, and a ratio between 0.5 and 0.6 for the major allele For each gene we calculated the probability that the major and minor ... Bioinformatics 2009, 25:167-174 Yoshida-Hata N, Mitamura Y, Oshitari T, Namekata K, Harada C, Harada T, Yamamoto S: Transcription factor, SP1, in epiretinal membranes of patients with proliferative ... Establishing, maintaining and modifying DNA methylation patterns in plants and animals Nat Rev Genet 2010, 11:204-220 Athanasiadou R, de Sousa D, Myant K, Merusi C, Stancheva I, Bird A: Targeting of...
- 12
- 458
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
Ngày tải lên :
10/08/2014, 05:20
... William Wheat for help with MLR and antigen uptake assays, Sarah Akkina and Jennifer Quick for help with maintaining hES cells and culturing cystic bodies We thank Leila Remling for isolating fetal ... from hES and FL derived CD34+ cells were stained with CD 1a and HLA-DR, CD 1a and B7.1, and CD 1a and B7.2 Results showed that hES derived DCs are positive for HLA-DR, B7.1, and B7.2 surface expression ... HIV/ AIDS, new and innovative approaches are essential [10,11] Gene therapy through intracellular immunization offers a promising alternative approach and possible supplement to current HAART...
- 9
- 261
- 0
Báo cáo y học: "Transcriptomic and phenotypic analysis of murine embryonic stem cell derived BMP2+ lineage cells: an insight into mesodermal patterning" ppt
Ngày tải lên :
14/08/2014, 08:20
... Sawano A, Iwai S, Sakurai Y, Ito M, Shitara K, Nakahata T, Shibuya M: Flt-1, vascular endothelial growth factor receptor 1, is a novel cell surface marker for the lineage of monocyte-macrophages ... Cao L, Setton LA, Haider MA: The pericellular matrix as a transducer of biomechanical and biochemical signals in articular cartilage Ann NY Acad Sci 2006, 1068:498-512 Lefebvre V, Huang W, Harley ... (cranial) and sacral Development 2003, (trunk) neural crest cells in vitro 130:4567-4579 Tomita Y, Matsumura K, Wakamatsu Y, Matsuzaki Y, Shibuya I, Kawaguchi H, Ieda M, Kanakubo S, Shimazaki...
- 28
- 288
- 0
Báo cáo y học: "nalysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET" pptx
Ngày tải lên :
14/08/2014, 20:22
... additional methods and materials and results Additional data file 16 is a summary of promoter array ChIP-chip binding data and corresponding ChIP-PET binding data for OCT4 and NANOG Additional ... GO categories are structured as a directed graph, we propagated the annotations backwards through the graph; a gene symbol was marked as annotated to a GO category if the annotation was contained ... hybridization chambers for 40 hours at 65°C using the Agilent hybridization protocol and reagents for 244 K arrays (Agilent, Santa Clara, CA, USA) Arrays were then washed and scanned as previously...
- 14
- 205
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 1
Ngày tải lên :
09/09/2015, 17:54
... aaagtgggcctttctccatc agccacatcgctcagacac gcccaatacgaccaaatcc tcagctacctgaagcacagc tagtcctggtgcaggctctt tgcctaagatgcccgactt agctgctggctggtgaag aaggacaagaagcgaagcat ttcctgtcatcccctggata aaggcctcatttgaagtatcctc ... R: ggagccgtagtgagcagttc atgcctcacacggagactgt aagtgggttgtttgcctttg ggcacagttagagccaactaaga ccgagcagcactaacacg gagaggcagctgagatcagaa tgagaatacgatgtctgcaggt gtggagagcaactccgatg tctgcagagctttgatgtcc ... ggcacacacacattaacacactt ggtgtgtgagagcaattctcag aggtggttgaccttcaatgg tttgatttcttccagcattgtg gagtctgcctgttgcagga cagcgtctgacagcgaca aagttcaacaacaactgctaccaa gaagctcgtcatgcagttca ttgctgcctctttaagactagga...
- 83
- 381
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 3
Ngày tải lên :
09/09/2015, 17:54
... al., 2010; Bond et al., 2009; Rapicavoli et al., 2010; Tochitani and Hayashizaki, 2008) LncRNAs are also dynamically expressed during neuronal-glia fate specification, and they appear to ... the siRNAtreated hESCs (B) From the microarray, a panel of pluripotency and lineages markers was analyzed and fold change values, relative to the si-NT control, were presented in a heatmap Pluripotency ... pluripotency maintenance, lncRNAs are dynamically regulated, and are important during mammalian development In particular, the brain is one of the most developmentally evolved and complex biological systems...
- 55
- 327
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 4
Ngày tải lên :
09/09/2015, 17:54
... signal and the DAPI stain confirmed that RMST is a nuclear-localized lncRNA (Figure 8.11B) Figure 8.11: RMST is a nuclear-localized lncRNA (A) Cellular RNA was separated into the nuclear and ... and cytoplasmic fractions by RNA fractionation, and abundance of the RNA transcripts in either fraction was assayed by qPCR The nuclear/cytoplasmic ratio was computed presented in the graph (B) ... Lmx 1a expression on an adjacent midbrain section during E11.5 to 14.5 At E14.5, Rmst expression is largely restricted to the ventral tegmental area (VTA), and not the laterally located substantia...
- 13
- 275
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
Ngày tải lên :
09/09/2015, 17:55
... Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors Cell 131, 861-872 Takahashi, K., and Yamanaka, ... Munoz-Sanjuan, I., and Brivanlou, A. H (2002) Neural induction, the default model and embryonic stem cells Nat Rev Neurosci 3, 271-280 Nakatani, T., Kumai, M., Mizuhara, E., Minaki, Y., and Ono, ... 1484-1488 Katayama, S., Tomaru, Y., Kasukawa, T., Waki, K., Nakanishi, M., Nakamura, M., Nishida, H., Yap, C.C., Suzuki, M., Kawai, J., et al (2005) Antisense transcription in the mammalian transcriptome...
- 34
- 316
- 0
Human embryonic stem cell derivatives as cancer therapeutics
Ngày tải lên :
09/09/2015, 18:52
... including malignant melanoma, Kaposi's sarcoma, colon cancer, ovarian cancer, pancreatic cancer, Ewing’s sarcoma, fibrosarcoma, breast cancer and renal cell carcinoma (Studeny et al 2002; Hung et al ... survival of animals was monitored accordingly SigmaStat (Jandel, San Rafael, CA) software was used for the statistical analysis of survival data All handling and care of animals was carried out according ... Dendritic cells (DCs) and cancer therapy 1.2 Adult stem cells and cancer therapy 1.2.1 Mesenchymal stem cells (MSCs) and their application in cancer therapy 11 1.2.2 Neural stem...
- 166
- 294
- 0
Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation
Ngày tải lên :
10/09/2015, 09:08
... their assistance in my research work and for making this journey a less arduous and more enjoyable one; Mohammad Shahbazi, Dang Hoang Lam, Yovita Ida Purwanti, Jiakai Lin, Chrishan Ramachandra, ... survival, proliferation and migration In general, extracellular cues activate intracellular signaling pathways, such as the Notch, Wnt, JAK-STAT and MAP kinase pathways, to effectuate transcriptional ... differentiation (Flanagan et al., 2006) Extracellular matrices interact with specific receptors on the surfaces of cells, such as integrins, to activate pathways that modulate a wide array of cellular...
- 146
- 511
- 0
Dual roles of transcription factor zic3 in regulating embryonic stem cell pluripotency and differentiation
Ngày tải lên :
11/09/2015, 09:02
... Oct4, Nanog and Sox2 co-occupancy and were frequently associated with Smad1 and Stat3 binding49 This suggests that Smad1 and Stat3 share many common target sites with Nanog, Oct4, and Sox2, and ... transcription factor The amino acid sequence of a prototypical transcription factor is illustrated, containing a DNA-binding domain (DBD), a signal sensing domain (SSD), and a transactivation domain (TAD) ... A B C Figure Transcriptional regulatory motifs between Oct4, Nanog and Sox2 and their common targets in ES Cells (A) Oct4 and Nanog share a small subset of target genes between mouse and human...
- 271
- 283
- 0
n vitro bioassembled human extracellular matrix and its application in human embryonic stem cell cultivation 1
Ngày tải lên :
11/09/2015, 10:06
... such as Parkinson’s disease, Alzheimer’s disease, heart diseases, stroke, arthritis, diabetes and spinal cord damage, can potentially be treated by cellular transplant therapy To test a large ... engineering and cellular transplant therapy, the gap between scientific research and clinical applications for safe and effective stem cell based therapies is still wide Generally, for hESCs to be applied ... instructions and incubated for days Samples were fixed with formaldehyde and immunolabeled with rabbit anti-β III tubulin (Abcam, ab18207) and Alexa Fluor 488 chicken anti-rabbit (Invitrogen) and DAPI...
- 45
- 284
- 0
n vitro bioassembled human extracellular matrix and its application in human embryonic stem cell cultivation 2
Ngày tải lên :
11/09/2015, 10:06
... DxSDOC and DxSDOCDOC matrices Mass spectrometry analysis was done in collaboration with Christopher Stephen Hughes and Prof Gilles Lajoie * Protein also found in GFR and standard Matrigel, based ... 105340 Keratin, type I cytoskeletal 10 Keratin, type II cytoskeletal Collagen alpha-1(I) chain*† Collagen alpha-2(I) chain*† EMILIN-1*† Fibrillin-1* Isoform of Collagen alpha-1(XII) chain Isoform ... similar to Alpha-2-HSglycoprotein 99.80% 3.00% Putative uncharacterized protein ALB 100.00% 7.81% Table 2: Consolidated list of protein identifications compiled from mass spectrometric analysis...
- 5
- 219
- 0
n vitro bioassembled human extracellular matrix and its application in human embryonic stem cell cultivation 3
Ngày tải lên :
11/09/2015, 10:06
... bind active TGFB, and could lead to a decrease in the amount of active TGFB available for the hESCs 3.5 Matrices that maintain hESC pluripotency 3.5.1 Population doublings of hESCs maintained ... matrix condition were sacrificed for cell counting using a haemacytometer Population doublings from each passage were calculated and the data plotted for comparison (Figure 5A) 53 54 55 56 57 ... not adhere to FcNP40/DNase matrices either, and also settled on the bottom of the culture well in clusters that were easily moved (Figure 4B) Taken together, DxSNP40/DNase and FcNP40/DNase matrices,...
- 7
- 212
- 0
n vitro bioassembled human extracellular matrix and its application in human embryonic stem cell cultivation 4
Ngày tải lên :
11/09/2015, 10:07
... of hESCs Phase contrast images of hESCs on both bio-assembled matrices and also the control hESCs were taken at an earlier passage, passage +5, and compared to a later passage at passage +20 (Figure ... passages, before losing the fast proliferation rate at the 14th passage From passage 14 to 15, population doublings remained stagnant, and only began to increase at the 16th passage By this passage, ... passages before the implantation was made, but remained unable to form teratomas It is likely that the control hESCs had lost their differentiation capacity by the 18th passage Teratoma assays...
- 16
- 232
- 0
n vitro bioassembled human extracellular matrix and its application in human embryonic stem cell cultivation 5
Ngày tải lên :
11/09/2015, 10:07
... tested metaphases of hESCs on Matrigel had normal karyotypes, while 19 out of 20 tested metaphases of hESCs on Matrigel had normal karyotypes; metaphase showed non-clonal random loss Again, as mentioned ... marker TRA-1-81, which is higher than that of hESCs on Matrigel at 75.2% Hence, at passage 5, hESCs on DxSDOCDOC expressed comparable pluripotency marker levels compared to the control and markers ... 3.5.6, these cells can be considered as karyotypically normal due to only metaphase out of 20 having non-clonal random loss, which could have been a result of technical artifacts or random mitotic...
- 14
- 209
- 0