a chunk object after the one allocation the allocated memory is shown in gray
A contrastive Analysis of the Metaphor “Anger is Heat” in English and the Possible Equivalent Expressions in Vietnamese
Ngày tải lên :
10/08/2015, 19:46
... methods The major method employed in this thesis is contrastive analysis to compare and contrast mechanism of the metaphor “Anger is Heat” in the two languages The intended instrumental language ... metaphor “Anger is Heat” in Vietnamese 2.2 The metaphor “Anger is Heat” in English and the equivalent in Vietnamese 2.2.1 The version “Anger is the Heat of a Hot Fluid in a Container” in English ... basis of the metaphor „Anger is Heat” in English and the equivalent in Vietnamese 2.1.1 The cognitive basis of the metaphor “Anger is Heat” in English 2.1.2 The cognitive basis of the equivalent...
- 12
- 843
- 9
university alabama press caborn-welborn constructing a new society after the angel chiefdom collapse aug 2004
Ngày tải lên :
11/06/2014, 13:01
... maintained; the elite had lost their power to command; and the regional center at Angel, as well as the surrounding villages, hamlets, and farmsteads, was abandoned Identifying the factors that ... ®oodplain and m below the second terrace It is low and ®at and made up of alluvial deposits that are Middle-Late Woodfordian in age In the Wabash drainage, it is known as the “Maumee Terrace” 26 Pre a. d ... Certain ceramic trends initiated during the Angel phase continued into the Caborn-Welborn phase They include widening and thinning of jar handles, an increase in the number of hemispherical bowls...
- 249
- 244
- 0
Báo cáo khoa học: "A COMFUTATIONAL THEORY OF THE FUNCTION OF CLUE WORDS IN ARGUMENT UNDERSTANDING" potx
Ngày tải lên :
08/03/2014, 18:20
... 78 in any case at any rate after all in spite o f that meanwhile rather than I would rather say The alternative is [Note 77 and 78 are whole phrases] II Attitudinal expressions These adverbs indicate ... run down highways need revamping buildings are crumbling sandbox area is a mess l )The grass is rotting 2 )The roads are dusty 3 )The city is a mess 4 )In particular, the parks are a ruin Preferred ... playground's safe EXAlt: 1 )The city is awful ~/I\4 2)First, no one cleans the parks 3)So the parks are ugly I \ 4)Then the roads are a mess 5)There's always garbage there Here, and contain the clues; and...
- 8
- 384
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
Ngày tải lên :
28/03/2014, 15:20
... when waves are breaking, a major part of the lost wave energy is dissipated directly in the shear layer beneath the surface roller, and only a minor part of it is transformed into turbulent ... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... with the distances from the boundaries towards the ends of the wave absorbing zones. Finally, at the ends of the wave absorbing zones, the Summerfeld radiation condition for long waves ...
- 11
- 460
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
Ngày tải lên :
30/03/2014, 04:20
... signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis provides ... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one- color microarray-based gene expression analysis ... Collagen, type IV, a5 , transcript variant Collagen, type IV, a6 , transcript variant B Collagen, type XVIII, a1 , transcript variant Laminin, a3 , transcript variant Laminin, a5 Laminin, c2, transcript...
- 14
- 597
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
Ngày tải lên :
18/06/2014, 17:20
... Data management was facilitated by the use of the MaxQDA qualitative data analysis package Results Of the 21 nurses interviewed, only four stated that they intended to remain in Ireland on a long-term ... interviewing began, it soon became clear that the "rich and experiential"[21] data emerging from the interview necessitated a small sample size to ensure that the quantity of data remained at manageable ... private sectors Unfortunately, beyond data on nationality and year of arrival as derived from immigration and registration data, no further information was available on the overall Page of 12 (page...
- 12
- 495
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
Ngày tải lên :
18/06/2014, 18:20
... supervision and interpretation of data analysis, and revised the manuscript NP aided in study design, analyzed and interpreted the data, and revised the manuscript Acknowledgements This work was ... United States Census classification and reflect parent report based on the following choices: White, Black, Native Hawaiian or Other Pacific Islander, Asian, American Indian or Alaskan native, Other ... cell disease, there was also a moderate ceiling effect in the family functioning summary scale and the worry scale Reliability and Validity The PedsQL™ Family Impact Module demonstrated acceptable...
- 11
- 552
- 0
Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx
Ngày tải lên :
09/08/2014, 03:24
... paper may be used to bridge these gaps In the lacquer tree, laccase may play a role in sealing-off damaged tissue It could also be involved in a defense mechanism against pathogens by oxidizing ... laccase catalysis is mainly distributed in the canals and their sheath cells, epithelial cells and the ducts with latex droplets In the control section, almost no deposit can be seen in the canals ... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate...
- 4
- 355
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
Ngày tải lên :
11/08/2014, 20:21
... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... Kosuta D: [Characteristics of war wound infection] Acta Med Croatica 2006, 60:353-63 Zhang J, Yoganandan N, Pintar FA, Guan Y, Gennarelli TA: Experimental model for civilian ballistic brain injury ... of war wounds at the time of injury Mil Med 2006, 171:826-9 Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser...
- 5
- 573
- 0
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx
Ngày tải lên :
12/08/2014, 11:22
... International Classification of Functioning, Disability and Health and the position of the variables included in the study by Brionez and colleagues [1] AS, ankylosing spondylitis; BASFI, Bath Ankylosing ... that persons with ankylosing spondylitis adapt positively to their (slowly progressing) disease, and tend to underestimate the health impact of the disease In clinimetric research, adaptation is ... seen as the major mechanism of a positive reference shift, which refers to the idea that patients not rate their health in reference to an absolute standard but in reference to a relative standard...
- 3
- 256
- 0
Báo cáo khoa học: "A systematic evaluation of the quality of meta-analyses in the critical care literature" pot
Ngày tải lên :
12/08/2014, 22:22
... primarily dealt with another area of medical practice Analysis The primary analysis of the data was descriptive The proportion of reports that met each of the criteria was determined and tabulated The ... Data were extracted from the reports regarding the individual components of the OQAQ, and a summary score was then determined Within the OQAQ instrument, there are nine individual items relating ... meta-analyses addressing critical care issues per year, 1994 to 2003 Comparison of the quality of meta-analyses in the critical care literature and in the emergency medicine, anaesthesia and general...
- 8
- 287
- 0
Báo cáo khoa học: "A comparative study of the complications of surgical tracheostomy in morbidly obese critically ill patients" pps
Ngày tải lên :
13/08/2014, 03:20
... greater than or equal to 40 kg/m2 Statistical analysis Parametric interval data were analyzed using a two-tailed Student's t test These data are reported as mean ± standard deviation Nonparametric ... rings The endotracheal tube was subsequently removed and a cannula was inserted into the distal trachea under visual control The skin was then sutured on both sides A chest radiograph was obtained ... drafted and edited the manuscript WJ conducted the literature search, collected the data, and performed the statistical analysis Both authors read and approved the final manuscript Page of (page...
- 6
- 485
- 0
Báo cáo y học: "A mathematical model for the adenylosuccinate synthetase reaction involved in purine biosynthesis" pot
Ngày tải lên :
13/08/2014, 16:21
... with the experimental data than the original model (calculations not shown) The second hypothesis states that ASP binds to the enzyme to form an AdSS·ASP complex, after which magnesium binds to aspartate ... assigned the same values as in the original model The best consistency of the modified model and the experimental data was attained at KmMg = 0.01 mM Overall, this modification is much less consistent ... competes against the substrate for binding to the enzyme, an 11-parameter model was proposed Although the kinetics of the AdSS-catalyzed reaction in the presence of the inhibitors SUCC, GDP, IMP, and...
- 11
- 311
- 0
Báo cáo y học: "A systematic review of the impact of sedation practice in the ICU on resource use, costs and patient safety" pptx
Ngày tải lên :
13/08/2014, 20:21
... improvements across all ventilation and patient stay outcomes in most studies suggest that a systematic management approach is clinically important The available data also support an association between ... pneumonia; and incidence of delirium Quantitative data synthesis Due to the wide range of included study types, no studies were suitable for quantitative data synthesis This was anticipated in advance ... Weatherburn C, Endacott R, Tynan P, Bailey M: The impact of bispectral index monitoring on sedation administration in mechanically ventilated patients Anaesth Intensive Care 2007, 35:204-208 Carson...
- 11
- 258
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
Ngày tải lên :
14/08/2014, 21:20
... photographed NAD+ measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... subjected the remaining 391 to a GOstats analysis (Table D in Additional data file 4) This list is enriched for genes involved in energy generation and genes involved in nicotinamide metabolism are also...
- 17
- 432
- 0
A study on improving the quality of human resource in Quang Ninh province customs department
Ngày tải lên :
17/03/2015, 12:53
... demands of training Make plans and training programs i fraining strategies T Training officers T Training documents F.quipment'venues 4.3.1 Defining the demands of training The plans of training ... improved About training, training and retraining have become effective and shown great progress Training steps based on international standards, labour force was basically standardized according to ... agree that the training and retraining programs bring effective results Chart 3.10 Effectiveness of traning and retraining program • Totally disagree • Disagree Parth agree • Agree • StronaK aarec...
- 107
- 683
- 0
Developing the competitive strategy for thien hoa’s supermarket system on a retail market of the electronic and electrical appliances in Hochiminh city
Ngày tải lên :
26/03/2015, 10:55
... now, there is micro, not macro-taking at the national level Also appearing term sustainable competitive advantage means that enterprises must continuously provide the market a special value that ... SPACE Matrix: The strategic positioning matrix and evaluation activities is a strategic planning tool during the combination of strategic analysis framework formed SPACE Matrix was Page 14 GaMBA01.C0111 ... Establishing annual goals are very necessary to implement the strategy because it is the basis for the distribution of the force resources, the evaluation mechanism for the administrators, it is...
- 110
- 572
- 1
a new approach to the global asymptotic stability problem in a delay lotka voltrra differential equation
Ngày tải lên :
29/10/2015, 14:19
... since the equation (ao +a& “) if (5.10) is satisfied 9.6 of Kuang b as it can be shown easily (see given in [2, p 351 when the delay 71 is small enough and the other delay gl is arbitrary It also ... “simple” formula and some basic comparison and oscillatory results from the theory of delay differential equations and inequalities This paper is organized as follows In Section 2, we obtain a priori ... speaking, we separate the negative feedback terms into two classes al, , ano and uno+i, , a, such a way that the delays belonging to the coefficients ui (1 I i I no) are small enough and...
- 20
- 305
- 0