... specific to sexual topics Although patients may initially react as though you have intruded into territory too personal to be shared, they are usually settled by a simple explanation as to the relevance ... attempts to stimulate her to orgasm (lifelong, situational anorgasmia) John is a 60-year-old married man who has not been able to achieve a satisfactory erection for years Morning erections are nonexistent, ... orientation, their ability to function as sexual beings, and any problems accumulated along the way The decision to be sexual, whether made after night or years, almost always has a relational meaning,...
... Researchers have found that the 10 DSM-IV-TR PDs can be expressed as maladaptive variants of the FFM factors and facets (Widiger & Costa, 2002) Two meta-analyses – Saulsman and Page (2004) and Samuel and ... factors were as expected, as compared to previous research When compared with the Saulsman and Page (2004) meta-analysis of FFM factors that predicted for the 10 PDs, all the FFM factors that ... 3.00(0.75) Note Standard deviations appear in parentheses Characteristic items defined as less than or equal to 2.00, or greater than or equal to 4.00, appear as underlined (low) or boldfaced (high) values...
... calculated using part weights * Part sample ** Part sample Harvard Medical School, Boston, USA for the analysis The analysis was done by the Statistical Analysis Software (SAS) program and was ... of Health Care Policy, Harvard Medical School, Boston, USA for their role in the data analysis We appreciate Dr Somnath Chatterjee, WHO, Geneva for his valuable guidance We are thankful to the ... at an earlier age Statistical analysis The data was entered in BLAISE software version 6.3.4.6, cleaned and sent to the Department of Health Care Policy, Page of 11 (page number not for citation...
... of human esophageal squamous cell carcinomas, adenocarcinomas and squamous cell carcinoma cell lines APMIS 116, 823–831 Aratake Y, Kotani T, Tamura K, Araki Y, Kuribayashi T, Konoe K & Ohtaki S ... 325–330 Masuyama J, Yoshio T, Suzuki K, Kitagawa S, Iwamoto M, Kamimura T, Hirata D, Takeda A, Kano S & Minota S (1999) Characterization of the 4C8 antigen involved in transendothelial migration ... putative FAP ligand, urokinase plasminogen activator receptor (uPAR), has been reported in LOX malignant melanoma cells [133,134] Because the uPAR ligand, urokinase plasminogen activator, is able...
... GGC GAA GGC CTA GGC GCA CTA ATG AAG TGG CCA GCA TCG CGG CCA ACA GAT GCC AGG AGG GCC GCC GTC GGG GCC TGG ATC ACC TAT ATA GTG GCC GGC CTT ATG CAG ACT ACC TCC CAG CAA TG TTT AGA GC GGG TGT AG C ... sequence ATT CGA ATA GGG TAT TCT TAT CCC (GTC (GGT GAA GTC CCA GTA GCC GGC CCA GAA CGG TCC GAC GGC TGG GCC CTG TCC CGA TGC CTG CCC Size GAC) ACC) TTC GAC GGC ATA GCC TTC GGC GTA AAT CCT AGG TGC CTA ... expression may be secondary to effects on integrins and ⁄ or DDR1 DPIV and FAP, although cell-surface molecules, are also cytoplasmically expressed and so may have similar cytoplasmic actions to DP8 and...
... z a0 − z a1 − a2 − z (r) This translates into a continued fraction of tanq (u): u tan(r) (u) = q a0 − a1 − u2 u2 u2 a2 − Cieslinski’s new q-tangent After a first draft about the Foata and Han ... q-exponential and q-trigonometric functions Appl Math Lett., to appear, 2011 [2] R Y Denis On (a) generalization of (a) continued fraction of Gauss Int J Math Math Sci., 4:741–746, 1990 [3] D Foata and ... G.-N Han The (t, q)-analogs of secant and tangent numbers Electronic Journal of Combinatorics, 18(2):#P 7, 2011 [4] M Fulmek A continued fraction expansion for a q-tangent function S´m Lothar e...
... indicator) We also demonstrated that ANG-IV exerted its protective action via both AT4 and AT1 receptors as divalinal ANG-IV (AT4 antagonist) and losartan (AT1 antagonist) were able to antagonize ... (AT4) (Loufrani, et al., 1999 and Ruiz-Ortega, et al., 2007) DAA-1 has been demonstrated to act through the AT1 receptor as the addition of losartan, an AT1 antagonist, was able to negate DAA-1 ... peptide, was known to have an effect on the angiotensin II proinflammatory pathway DAA-1 treatment was also found to be able to attenuate weight loss, neutrophil infiltration and alveolar cell damage...
... transparent are filled in • Draw in Transparent Area: Only the transparent area of a selection is filled in • Draw in Transparent and Closed Area: Only areas that are either completely enclosed or are ... Closed Area: Only areas that are completely closed (that is, an ellipse or rectangle) are filled in within the selection • Protect Transparent Area: Only areas of the selection that aren’t transparent ... thousands) of readers in an instant There’s nothing quite like instant gratification Add on a message board or blog (or at least an e-mail address), and you can cultivate a loyal fanbase that eagerly...
... drunk as a lord as drunk as a skunk to swear like a trooper to swear like as busy as to swear like a bargee as busy as a heaver as busy as a bee 45 3.3.2 Synonymous idioms in Vietnamese In Vietnam, ... forms and figurative meanings and reflect their own nation's culture values, including material and spiritual values Idiomatic variants are idioms which have the same meanings and grammatical structures ... gold hard and fast (can not be changed in any circumstances): There are no hard and fast rules about this 29 Idioms as adverbial phrases e.g as likely as not (certainly/ surely): He’ll be at home...
... $20) to have an account balance below $800 and be subject toa margin call The trader would be obligated to meet the call to re-establish the account balance to 1,000, or be subject to automatic ... expiration and be automatically offset at the USDA’s announced price for Class III and IV Milk What is a Futures Contract? A futures contract is a legally binding obligation to buy or sell a commodity ... prior to contract expiration, or by accepting an automatic offset at the Class III announced price on the date of the announcement Although it's risky, it's that easy Let's look at an example What...
... binding characteristics and hyperanticoagulant activity Binding ability was established using a SPR membrane binding assay and anticoagulant activity was assessed by a thrombin generation assay The ... had a 20-fold higher anticoagulant potential than human wild-type APC [16] Although this was a simple end point assay, the anticoagulant potency of human APC variant QGNSEDY in human plasma parallels ... interaction to the cofactor and thus influence the anticoagulant activity of APC An influence of position 23 on the interaction to APC substrates FVa and FVIIIa also cannot be ruled out The same reasoning...
... data for chicken were taken from [44] Chicken H101 H110 H102 H103 H11L H11R H5 a- S a- S a- S a- A a- S a- A a- pT T T T pT T pT pS AAAAAAAAAAA P – pS P P P P AA – P A S AAA P AAAAA ... a- T a- pS a- pS a- S a- pS a- pS N pT A T pT pT pS AAAAAAAAAA E aK S A P P P – aK aK 2mK K K – P A pT pT pS – aK K K K K – mK K K K K K A mK T K K K K R R R mR S K a ⁄ mK a ⁄ mK mK mK D A ... a- S a- pS N T T T T T S V AAAAAAAAA E – S A P P P – K aK aK aK aK – P A pT pT pS – aK K K K K – K K K K K K P A K A K K K R R R R S K aK aK aK K D A pS pS pS T S S S S S S A Q auK auK auK...
... 2008 Natarajan AM, Balasubramani P and Tamilarasi A, Operations Research, Pearson Education, First Indian Reprint, 2005 Hamdy A Taha, Introduction to Operations Research, Prentice Hall India, Seventh ... of data – Qualitative Vs Quantitative data analyses – Bivariate and Multivariate statistical techniques – Factor analysis – Discriminant analysis – cluster analysis – multiple regression and ... Management, Tata McGraw Hill, Third Edition, 2008 Chase Jacobs, Aquilano & Agarwal., Operations Management, Tata McGraw Hill, 2006 Mahadevan B, Operations Management Theory and practice, Pearson...
... (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), and the antisense primer (5¢-GTAACGCCAGGGTTTTCCCA GTCAC-3¢) ... sufficient to impact greatly on the catalytic activity, as the kcat and the ETF interaction are relatively unaffected This mutation seems to affect mainly the initial folding and stability of the tetramer, ... due to an A4 21V substitution causes glutaric acidemia type I in the Amish Am J Hum Genet 59, 1006–1011 Merinero B, Pascual Pascual SI, Perez-Cerda C, Gangoiti J, Castro M, Garcia MJ, Pascual Castroviejo...
... for b1 were GTCAGCTAGCTAACGAGGTGG AGTCCGGTTAC and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2 GTC AGCTAGCCCGTCCCTGTGACTGTGATG and GTC ACTCGAGCTAGGCTTGACAGCCTGCAGGG, respectively ... polyvalent antisera against the natively folded fragments b1IV and b2IV in order to re-examine some of the previous data and to establish more quantitative and sensitive assays The rabbit antisera ... extracts were analysed by the b1IV and b2IV assay and also by an assay speci®c for the laminin c1 chain [37] This demonstrated that 71±93% of the extractable laminin c1, b1 and b2 chain were already...
... a water seal tank to maintain water on the seals for lubrication purposes and so that water rather than air leaks into the machine in case the seals break or leak 15 The water seal tank has a ... glasses on the evaporator, absorber, and generator Evaporator sight glass water level The normal operating evaporator tank water level is approximately inch above the horizontal centerline At a ... of a D/X coil solenoid valve and modulating control of a face and bypass damper load It also modulates the face and bypass dampers to mix the cooled air with the bypassed air as necessary to maintain...
... NA hp0547 Cagf ⁄ Cag1 Cage ⁄ Cag2 Cagd ⁄ Cag3 Cagc ⁄ Cag4 Cagb ⁄ Cag5 Caga ⁄ VirB11 CagZ CagY CagX CagW CagV CagU CagT CagS CagQ CagP CagM CagN CagL CagI CagH CagG CagF CagE CagD CagC CagB CagA ... complete cag pathogenicity island sequence in four Helicobacter pylori isolates Gene 328, 85–93 12 Azuma T, Yamakawa A, Yamazaki S, Ohtani M, Ito Y, Muramatsu A, Suto H, Yamazaki Y, Keida Y, Higashi ... translocation factors CagF, CagZ and Cagb are all predicted to be localized in the bacterial cytoplasm or at the inner membrane, each of them could fulfill a function as signal recognition factor...
... interactions with CagM, Cagd, CagF and CagZ and, toa minor extent, with CagT and the VirD4 homologous Cagb [16] Analogous to cagI, cagG deletion mutants are incapable of delivering CagA into gastric ... components (CagZ, CagS and CagD) is now available, along with Caga ATPase The lack of a clear picture of the biological function and organization of some cagPAI components is also a major obstacle to structural ... whereas Cage was not detected at all Interestingly, the expression levels of cagC and cagf reached values analogous to genes important for bacterial survival and homeostasis, such as catalase,...
... an NHMRC Career Development Award fellowship References Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1996) The whole structure ... These nDNAencoded assembly factors arenot associated with assembled complex IV but instead act at various functional levels, ranging from subunit insertion and co-factor attachment to regulation ... resolved after 10 of import (Fig 2A, lanes 3, 4, and 10) Radiolabeled Cox6b also appeared to be incorporated into the holoenzyme, albeit weakly (Fig 2A, lanes and 6), while 35 S-labeled Cox4-1 was not...