a case history of a highly protein bound drug
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt
Ngày tải lên :
07/03/2014, 16:20
... 5Â-ACTGAAGGTGCC ACTTCACAAAGCTAYAARCARTT-3Â; abrin 3: 5Â-GGT TAAACACTTCCCGTTGGACCTDATNGT-3Â) was chosen to represent the possible coding sequences of the conserved N-terminus of the pulchellin A- ... based on DNA sequences obtained previously Thus, the sequences of the primers used for 5Â RACE were: 5Â-GGGCATCACGGA AGAAATAG-3Â for a reverse transcription and 5Â-GC TCTAGAGCATTCGTCACATCGATACC-3Â ... USA) Restriction endonucleases, and DNA ladders were obtained from Promega Factor Xa protease was purchased from Biolabs (Beverly, MA, USA) All other chemicals used were analytical grade Plant...
- 10
- 390
- 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
Ngày tải lên :
29/03/2014, 23:20
... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... (Table ) Loop (9–12) and loop (18–23) create a b-turn A characteristic of the PAF loop regions is the recurring asparagine–aspartate or aspartate–asparagine (Asn18– Asp19, Asp32–Asn33, Asp39–Asn40)...
- 16
- 408
- 0
Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx
Ngày tải lên :
30/03/2014, 11:20
... FEBS Y Mukaiyama et al Characterization of bHLH-PAS -A of NPAS2 Table Resonance Raman spectra of the basic helix–loop–helix (bHLH)-PAS -A domain of neuronal PAS domain protein Excitation was at 413.1 ... kinetic analyses We found that the bHLH domain significantly affects the spectra of the heme -bound PAS -A domain and appears to assist in stable heme Characterization of bHLH-PAS -A of NPAS2 binding, ... holo-NPAS2 holo-NPAS2 holo-NPAS2 holo-NPAS2 a p o- N PAS apo-NPAS2 apo-NPAS2 apo-NPAS2 BSA apo-NPAS2 ∆ F (Hz) A Characterization of bHLH-PAS -A of NPAS2 T ime (s) ∆ F (Hz) 1000 500 holo-NPAS2 holo-NPAS2...
- 12
- 360
- 0
báo cáo khoa học: " Hypothyroidism in a five-year-old boy with rhabdomyolysis and recent history of cardiac tamponade: a case report" pptx
Ngày tải lên :
10/08/2014, 23:20
... Author details Universidad Francisco Marroquín, 19 Ave 8-44 Zona 15, Vista Hermosa I, Guatemala City, Guatemala 2Department of Pediatrics, Roosevelt Hospital, 5ta Avenida Calzada Roosevelt, Zona 11, ... rhythmic and no pericardial rub was heard An anterior mid-thoracic scar was noted where the percutaneous pericardial catheter had been placed He had hepatomegaly that was later confirmed on an ultrasound ... caused a tamponade on an echocardiogram, causing right atrial and ventricular collapse (Figure 1) Emergency percutaneous pericardial catheter drainage was placed, draining 200 mL of serous clear...
- 4
- 292
- 0
Báo cáo y học: " The natural history of West Nile virus infection presenting with West Nile virus meningoencephalitis in a man with a prolonged illness: a case report" doc
Ngày tải lên :
11/08/2014, 00:23
... positive (acute and convalescent phase) A brain MRI scan (Figure 1C) obtained on day 21 revealed resolving inflammatory changes in the basal ganglia and thalamus Six weeks later he was fully oriented ... Mainali et al Journal of Medical Case Reports 2011, 5:204 http://www.jmedicalcasereports.com/content/5/1/204 one of the survivors of WNND The significance of this case is that serial brain magnetic ... to the writing and editing of the manuscript All authors read and approved the final manuscript Mainali et al Journal of Medical Case Reports 2011, 5:204 http://www.jmedicalcasereports.com/content/5/1/204...
- 4
- 310
- 0
báo cáo khoa học: "Long-term misuse of zopiclone in an alcohol dependent woman with a history of anorexia nervosa: a case report" pps
Ngày tải lên :
11/08/2014, 02:22
... abnormalities She had a long history of both anorexia nervosa and alcohol dependence Anorexia was first diagnosed in 1994, and when she was 17 years old she was treated as an inpatient By the age of ... events or trauma She also has a history of self-harm, overdosing, burning Page of and lacerating; her last admission to Accident and Emergency was two years ago Her father died of alcohol-related problems ... dependent woman with a history of anorexia nervosa: a case report Journal of Medical Case Reports 2010 4:403 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient...
- 4
- 272
- 0
Báo cáo y học: "Primary osteosarcoma of the urinary bladder treated with external radiotherapy in a patient with a history of transitional cell carcinoma: a case report" pptx
Ngày tải lên :
11/08/2014, 11:23
... prostate and bowel carcinomas: report of a case and review of the literature Arch Pathol Lab Med 2001, 125:793-795 10 Kato T, Kubota Y, Saitu M, Yaguchi H, Sasagawa I, Nakada T, Yuda F: Osteosarcoma ... Rodríguez Alonso A, González Blanco A, Bonelli Martín C, Nogueira Carballedo C, Garc a Rego JA, Cachay Ayala M, Lorenzo Franco J, Cuerpo Pérez MA, Nieto Garc a J: Primary bladder osteosarcoma treated ... recurrence after 51 months of combination treatment with radical cystectomy and chemotherapy [11] A case of bladder osteosarcoma with markedly remission of pulmonary metastases after chemotherapy has also...
- 3
- 361
- 0
Báo cáo y học: "Peripheral primitive neuroectodermal tumor of the urinary bladder in an Arab woman with history of squamous cell carcinoma: a case report" doc
Ngày tải lên :
11/08/2014, 17:21
... neuroectodermal tumor of the urinary bladder in an Arab country The Department of Surgery of Al Sabah Hospital, Kuwait admitted a 67-year-old diabetic and hypertensive Arab woman in February 2006, ... severe hematuria and fever In January 2005, the woman had already been treated in a hospital of Great Britain for repeated hematuria for the duration of one year During this initial admission, ... your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Page of (page number...
- 4
- 306
- 0
Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps
Ngày tải lên :
11/08/2014, 19:21
... dysmorphism, clinodactyly of the fifth finger and mild learning disability The maternal grandmother was also assessed and was phenotypically normal The proband's father was not available for assessment, ... paternal sample was unavailable but FISH analysis of the mother, grandmother and siblings of the proband revealed a normal diploid compliment in each case for all of the investigated clones At present, ... imbalances The ability to accurately map breakpoints means that aCGH has become an efficient strategy in identifying candidate chromosomal loci and genes This case report highlights the use of aCGH...
- 6
- 376
- 0
Báo cáo y học: " Accidental carbon monoxide poisoning presenting without a history of exposure: A case report" pdf
Ngày tải lên :
11/08/2014, 23:21
... necrotic fibres (arrows) that are infiltrated by macrophages, with a surrounding aggregate of macrophages and lymphocytes Page of (page number not for citation purposes) Journal of Medical Case Reports ... oxygen Arterial blood gas examination was normal at this stage, although critically carboxyhaemoglobin levels were not measured ECG revealed inferolateral T wave inversion Chest X-ray was normal ... oximetry had revealed haemoglobin saturations of 91% on air rising to 96% with oxygen administration He had a large sacral pressure sore and a rash on his left leg On arrival in the accident and emergency...
- 4
- 205
- 0
Báo cáo khoa học: "A highly divergent South African geminivirus species illuminates the ancient evolutionary history of this family" ppsx
Ngày tải lên :
12/08/2014, 04:21
... the data and prepared the manuscript All authors read and approved the final manuscript Additional material Additional File Supplementary Figure Discovery of a divergent monocotyledonous grass ... monopartite tomato leaf curl Java begomovirus Arch Virol 2007, 152:1273-1282 Vanitharani R, Chellappan P, Pita JS, Fauquet CM: Differential roles of AC2 and AC4 of cassava geminiviruses in mediating synergism ... Natl Acad Sci USA 2008, 105:157-161 Gopal P, Pravin Kumar P, Sinilal B, Jose J, Kasin Yadunandam A, Usha R: Differential roles of C4 and betaC1 in mediating suppression of post-transcriptional...
- 12
- 287
- 0
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx
Ngày tải lên :
13/08/2014, 01:21
... K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, et al: Adaptation of HIV-1 to human leukocyte antigen class I Nature 2009, 458:641-645 Gaschen B, Taylor ... Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona (J M Miro, M López-Dieguez, F Agüero, JA Arnaiz, T Pumarola, M Plana, M Tuset, MC Ligero, C Gil, T Gallart, JM Gatell) ... individuals in the same geographical area and demographic risk group, drawn from the SPARTAC trial and the St Mary’s Hospital Acute Infection Cohort [38], as well as the LANL UK reference database...
- 14
- 360
- 0
Báo cáo y học: "Case report of right hamate hook fracture in a patient with previous fracture history of left hamate hook: is it hamate bipartite" pps
Ngày tải lên :
13/08/2014, 14:20
... some cases, it is rather curious to us that one wrist was apparently fractured while playing golf and the other not, approximately one year apart We conclude that this is a case of bilateral fracture ... F, Faltaous A, Baumgarten T: Bilateral hook of the hamate fractures Orthopedics 1997, 20(5):470-472 Bhalla S, Higgs P, Gilula L: Utility of the radial-deviated, thumbabducted lateral radiographic ... surface of their forearm lies against the film with slight radial rotation and the long axis of their hand is made as vertical as possible The central ray is directed toward the palmar surface...
- 7
- 277
- 0
Computational studies of host pathogen protein protein interactions a case study of the h sapiens m tuberclulosis H37RV system
Ngày tải lên :
10/09/2015, 09:08
... Number of related pathways Summary of the number of identified related pathways within and among databases Summary of number of pathways, average number of genes per pathway and average ... effective analysis of the integrated host-pathogen interaction data The development of software and database tools dedicated to hostpathogen interaction data collection, integration and analysis are also ... (2011) have also obtained similar results from analyzing the same pathway data: human signal transduction pathways derived from Pathway Interaction Database (PID)(Schaefer et al., 2009) and Reactome(Joshi-Tope...
- 211
- 310
- 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
Ngày tải lên :
21/09/2012, 10:39
... contained a core of Afro-Mediterranean race and spoke an Afroasiatic language Egyptian civilisation displayed many cultural and political patterns later to appear elsewhere in the continent, although ... rainfall declined thereafter, Nilo-Saharan speakers may have carried this culture and later the exploitation of grain southward towards Lake Victoria, although there is as yet no archaeological ... contrast with the characteristically tall and slender Nilotic peoples whose languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early...
- 386
- 1.2K
- 4
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
Ngày tải lên :
24/09/2012, 17:19
... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... was clear and well dressed neat and trained staffs” Therefore MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger ... jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are powerful and can be a great change for a brand • Be different and...
- 88
- 986
- 8
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
Ngày tải lên :
13/04/2013, 10:29
... (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities of ... managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations Brand Personality PRODUCT Country of ... of Planning and Investment, Vietnam Chamber of Commerce and Industry, from the Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected...
- 67
- 974
- 0
COMPETITIVE ADVANTAGES IN OFFICE FURNITURE INDUSTRY IN VIETNAM: A CASE STUDY OF SON THUY COMPANY
Ngày tải lên :
13/04/2013, 21:58
... business administration, management and law are favor of a theoretical approach rather than practical problem Information about enterprise as a whole and SMEs in particular is very scattered which causes ... as all types of chairs, all types of steel cabinets and all types of tables in Vietnam market according to all the designs of products that Son Thuy learn from Thailand, Malaysia, and Singapore ... two main parts based on two main sources of data collection The first part of the research is based on secondary data for analysis In chapter 1, the rationale and objectives of the research will...
- 71
- 1.1K
- 7
ENTRY STRATEGY INTO VIETNAMESE ENVIRONMENTAL MARKET A CASE STUDY OF ALTECH ENVIRONMENT PTE LTD
Ngày tải lên :
22/04/2013, 14:21
... dishwater, as well as a variety of chemicals if it comes from an industrial or commercial area It also carried microorganisms that may cause disease and organic material that can damage lakes and streams ... became a member of the Association of Southeast Asian Nations (ASEAN) and, thereby, of the ASEAN Free Trade Area (AFTA), and signed a memorandum of understanding for 25 commercial cooperation ... or change this asymmetry." Relations between the USA and states of NorthEast Asia - notably Korea, Japan and Taiwan - have been primarily conditioned by the American perception of a strategic...
- 72
- 837
- 2
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM
Ngày tải lên :
23/04/2013, 10:29
... modification in area of analysis 1.5 Limitation The unavailability of information about sales volume of each product categories, timing of sales of each product, and expenditure on activities such as ... strategic management Hill and Jones (1998) say a company has a competitive advantage when its profit rate is higher than the average for its industry and it can sustain this advantage to maintain high ... mass market as their target market Customers in this market are featured with average income and average living standard Geographically, the market of the company is in Hanoi and vicinity area...
- 75
- 920
- 4