... constraints of distance learning programmes for health care workers Distance learning in Tanzania faces many challenges and constraints. Resources are inadequate, including funding, space for face-to-face ... Clinical Assistant and Clinical Officer Training Centres in Maswa, Kilosa, and Kigoma, as well as the other organisations and educational institutes in Tanzania that allowed the assessment teams to conduct ... of Tanzania; 2007. 3. International Training and Education Center on HIV (I-TECH): Tanzania Distance Learning Assessment: Assessing the Use of Distance Learning to Train Heatlh Care Workers in
Ngày tải lên: 18/06/2014, 17:20
... nant mode of fielding as o pposed to a very minor pro- portion that occur as large-scale commercial fielding enterprises. Agricultural land area in Ghana estimates to about 58.3% of total land ... term. This is a preliminary study in which minimal baseline scenarios have been used relevant for biosafety assessment for African agriculture taking into account an African environmental perspective. ... study was carried out within a peri-urban district of Accra, the capital city of the Republic of Ghana. The methods used had been adapted to the Ghanaian agri- cultural and environmental conditions
Ngày tải lên: 21/06/2014, 05:20
báo cáo khoa học: " Tic20 forms a channel independent of Tic110 in chloroplasts" pot
... CTCCTTTGATGTCCTCTACC Ps18SrRNA CCAGGTCCAGACATAGTAAG GAGGGTTACCTCCACATAG CTTAGTCGTACGGAATCTGG AtTic20-I AGGTTATAGGGACCGTTAGC qRT-PCR AtTic20-IV CTATGTCCAACCTTTTCTCG CTGTTTCAAGAAGCATACCC RNA isolation, cDNA preparation, ... symbolise a-helical transmembrane domains (TM 1-4). IMS - intermembrane space. (C) The mature parts of Tic20 from Pisum sativum (PsTic20, amino acids 83-253) and Arabidopsis thaliana (AtTic20 amino acids ... [GenBank: Z68506.1], AtTic110 CTAAAGGAGTGGTCTTGTCG GCAGAAGATAATGCTCCATC At18SrRNA AACTCGACGGATCGCATGG ACTACCTCCCCGTGTCAGG Gene-specific primers generated for PsTic20, PsTic110, Ps18SrRNA, AtTic20-I,
Ngày tải lên: 11/08/2014, 11:21
the rule of accounting in the germany financial system
... role in financial contracting (e.g. Watts and Zimmerman 1986). Financial claims and control rights are often defined in accounting terms. For instance, debt contracts use accounting numbers and ... properties of an existing accounting system can also shape financial contracting. A comparison of debt contracting in Germany and the US provides an illustrative example in this regard (Kübler ... information channels In the following,... activities of private standard setting bodies such as the Financial Accounting Standards Board (FASB) or the International Accounting Standard
Ngày tải lên: 03/11/2014, 12:37
A Comprehensive Analysis of Chattering in Second Order Sliding Mode Control Systems
... Analysis of Chattering 41 For linear plants and linear actuators: • A methodology of approximate analysis of the amplitude and the frequency of chattering via application... Fridman, ... stability of fast periodic motions in a vicinity of the second-order sliding set are derived via the Poincar´e map approach. In Section 5, frequency-domain approaches to chattering analysis are ... Assumption 3 is always satisfied in the special case of a linear asymptotically stable actuator dynamics. Assume, only temporarily, that there exists a certain constant H such that | ˜ H(s, w)|≤H,
Ngày tải lên: 01/07/2015, 09:18
Work environment as a motivating factor for self improvement of english A case study of projects in cảe internatinal in viet Nam
... because the study involves a specific case of projects in CARE International in Vietnam Another reason is that the author has been a part of the “natural setting” She has been working in CARE International ... is an illustration, education and learning is a life-long process and in any environment, even after graduation or not in an educational setting, learning is always taking place and motivation ... level of validity and reliability of the data Findings Regarding the types of motivation possessed by CARE staff, the research has found out that 95.6 % CARE staff have integrative and intrinsic
Ngày tải lên: 04/08/2015, 09:42
A quantitative assessment of arboreality in tropical amphibians across an
... conservation of Philippine amphibians. (eds Das I, Haas A & A.T. A), pp. 2649. Universiti Malaysia, Sarawak, Malaysia. Dirzo, R. & Raven, P.H. (2003) Global state of biodiversity and loss. Annual ... M.J.D. (1990) Variation in the insect fauna of Sulawesi trees in season, altitude and forest type. Insects and the Rain Forests of South East Asia (Wallacea). A special Project Wallace Symposium ... A quantitative assessment of arboreality in tropical amphibians across an elevation gradient: can arboreal animals find above-ground refuge from climate warming? Brett Ryan Scheffers
Ngày tải lên: 10/09/2015, 09:11
ON IMAGINING a NATION CONSTRUCTIONS OF INDONESIA IN JAKARTA, KUPANG AND BANDA ACEH
... imaginings of Indonesia 5 that show various patterns... Merauke, itulah Indonesia Tapi dalam kehidupan sehari-hari nggak ada Sabang, nggak ada Merauke Bahkan jarang orang ada yang tau Sabang ... sesuatu golongan adat-istiadat, tetapi milik kita semua dari Sabang sampai Merauke!” 1 “Kalau kita bilang ‘Sabang sampai Merauke’, Dari lagunya aja ‘Sabang sampai... contrasting “us” consists of ... Manusia Indonesia: Sebuah Pertanggungjawaban (The Indonesian, an Account) Yayasan Obor Indonesia. MacRae, Grame. 2010. “If Indonesia is Too Hard to Understand, Let’s Start with Bali.” Journal of Indonesian
Ngày tải lên: 10/09/2015, 09:31
A pharmacoeconomic evaluation of bisphosphonates in the management of postmenopausal osteoporosis in singapore
... CCOHTA. Guidelines for economic evaluation of pharmaceuticals: Canada 2nd ed. Ottawa: CCOHTA; 1997. 44. Singapore Health Science Authority, Database Search [Online]. Available at: http://app.internet.gov.sg/scripts/hsa/CPA_search/CPA_databasesearch.asp. ... 3rd, et al. Increments in bone mineral density of the lumbar spine and hip and suppression of bone turnover are maintained after discontinuation of alendronate in postmenopausal women. American Journal ... 3):S21-27. 88. Adami S, Passeri M, Ortolani S, et al. Effects of oral alendronate and intranasal salmon calcitonin on bone mass and biochemical markers of bone turnover in postmenopausal women with
Ngày tải lên: 26/09/2015, 09:39
Immersive simulation games a case study of learning in a 3d multi user virtual environment
... representations in digital games are also known as the avatars, often referred to as a personal digital and graphical representation of their real self. Celia Pearce inferred that in games, the “addition ... even voice of the virtual graphical appearance of avatars. It was argued that such social factors of CMC played a more substantial role in the factors influencing “trust, attraction and friendships” ... various sources of ethnographic observations of avatars’ behaviours in the VLE; screen captures of avatars activities in the simulation game, transcript of avatars’ local chat communications and
Ngày tải lên: 02/10/2015, 17:14
A case study of learning in a 3d multi user virtual environment
... representations in digital games are also known as the avatars, often referred to as a personal digital and graphical representation of their real self. Celia Pearce inferred that in games, the “addition ... even voice of the virtual graphical appearance of avatars. It was argued that such social factors of CMC played a more substantial role in the factors influencing “trust, attraction and friendships” ... various sources of ethnographic observations of avatars’ behaviours in the VLE; screen captures of avatars activities in the simulation game, transcript of avatars’ local chat communications and
Ngày tải lên: 09/10/2015, 11:06
A contrastive analysis of premodification in english noun phrase and vietnamese equivalent
... Describing theoretical premises of pre-modification of noun phrases - Collecting and classifying materials, analyzing and synthesizing all information about pre-modification of noun phrases in English ... learners to master English grammar Grammar plays an important role in both writing and speaking as well If we know the meaning of words, without knowing about the rules of combining words into sentences ... theoretical background of noun phrase in English and Vietnamese Before making a contrastive analysis, I list main types of pre- modification of noun phrases in English and Vietnamese Last but not least,
Ngày tải lên: 06/06/2016, 21:24
Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort
... Neuroscience, a Michael Smith Foundation for Health Research (MSFHR) Scholar, a Canadian Institutes of Health Research (CIHR) New Investigator, and a Heart and Stroke Foundation of Canada’s Henry JM SC Barnett’s ... This is a critical research area to develop in order to appropriately tailor future intervention... longitudinal data that examines factors that explain variation in wellbeing among older ... Covariates included age, FCI, TUG, PPA and baseline ICECAP-O score, and the weight 213 and value of the missing variable in the preceding period The final imputed value was the mean
Ngày tải lên: 25/08/2016, 22:07
DSpace at VNU: Implementing Corporate Social Responsibility Towards Sustainable Development: A Case Study of SMEs in Thanh Hoa Province
... “Corporate Social Responsibility: A Study on Awareness of Managers and Consumers in Vietnam”, Journal of Accounting and Taxation, Vol 3, No 8, pp 162-170 Pham, Van Duc (2010), “Corporate Social Responsibility ... Academy of Management Review, Vol 4, No 4, pp 497-505 [6] Chen, C H., Wongsurawat, W (2011), “Core Construct of Corporate Social Responsibility: A Path Analysis”, Asia-Pacific Journal of Business Administration, ... Corporate Association and Consumer Product Responses”, Journal of Marketing, Vol 61, No 1, pp 68-84 [5] Caroll, A B (1979), “A Three-dimensional Conceptual Model of Corporate Performance”, The Academy
Ngày tải lên: 15/12/2017, 23:16
A comparative study of insults in vietnamese and american english
... being female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group of data for each social factor of age, as ... need treating with great care in both cultures can be found in situations 4, 5, and (the hearer was commented as naïve, as rabit and as having an opulent social life after having two dinners at her/his ... occur leading to the producing of unintentional insults For language learning and using, in order to effectively interact in inter-cultural interactions, language learners and users must have such...
Ngày tải lên: 26/11/2013, 13:16
A discourse analysis of advertisements in english and vietnamese on the internet
... the aim was to convince maintained the audience's attention them to buy a product at a nearest shop for example Vietnamese ads Another communication function is metalingual one When analyzing ads ... (expressing emotional states: a cry, a sign: emphasis on addresser) 3.Conative (influencing behaviour: ordering, begging, emphasis on addressee) 4.Phatic (e.g Hello! establishing or maintaining social ... similarity was found is the application of ellipsis in parallel were also found in Vietnamese ads on the internet structures to ensure the beat and rhythm of the syntagm in the ads in As in Metalingual...
Ngày tải lên: 26/11/2013, 13:29
A discourse analysis of advertisements in terms of persuasion strategies in english and vietnamese
... evaluative similarities between EAs and VAs adjectives appear in all six persuasive strategies “Make messages In terms of the layout features, both EAs and VAs have more persuasive”, “Increase, ... commonly in both EAs percentage in EAs than in VAs The third similarity involves and VAs (19.6% in EAs and 21.5% in EAs) and no Headlines found hyperbole It only appears in persuasive strategy “Make ... evaluative adjectives are main parts In the Headline, the similarity is that the headlines for not the same in two kinds of data They account for a higher persuasive strategy “Add incentives” are used...
Ngày tải lên: 26/11/2013, 13:29
A contrastive analysis of requests in english and vietnamese = so sánh lời đề nghị trong tiếng anh và tiếng việt luận văn tốt nghiệp đại học
... command, and consisting of a main clause and sometimes one or more subordinate clauses” Nguyễn Lân, a Vietnamese grammarian, has also given out a full definition of the sentence saying that “Many ... combined to show a clear sense about actions, states or characteristics of things are called a sentence (quoted by Đỗ Thị Kim Liên, 1998, p.100) According to Vinagradov, a Russian grammarian professor, ... politeness is associated with situations in which one “speaks or behaves in a way that is socially and culturally acceptable and pleasant to the hearer” From these definitions, Lakoff (1975) approaches...
Ngày tải lên: 14/12/2013, 00:40
A contrative analysis of exclamation in english and vietnamese
... statement that imparts information, it may also have the power of a threating act By making this statement, the teacher may also have performed a threating act Similarly, when one friend tells another ... as and exclamation or as a declaration From the above things about general speech acts we want to study a small scale that is exclamative mood which is involved in the fifth kinds of speech act ... with What In exclamation formed with What, we use a/ an with singular countable nouns after what and there is note that a/ an can not be used in exclamation with uncountable noun What + a/ an + (Adj)...
Ngày tải lên: 14/12/2013, 00:40
A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh
... the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists were very reactionary, combative and cruel ... we break off all relations of a colonial character with France; (42) We repeal all the international obligation that France has so far subscribed to on behalf of Vietnam and we abolish all the ... standing in the border At that time, the conflict between Britain-France-America and Russia might lead Britain and America to make concessions with France and allow France to come back to Indochina...
Ngày tải lên: 14/12/2013, 00:41