a cancer of the deepest layers of the skin is called

Tài liệu The OSI Model: Understanding the Seven Layers of Computer Networks ppt

Ngày tải lên : 24/01/2014, 09:20

... the discussion of networking often includes talk of “extra layers , this paper will address these unofficial layers as well. Finally , this paper will draw comparisons between the theoretical ... either hardware or software or, as with most protocol stacks, in a com- bination of the two. The nature of these stacks is that the lower layers do their work in hardware or firmware (software ... loading an application (such as Web browser or e-mail); that is, this application layer is the data the user views while using these applications. Examples of application layer functionality include: •...

11
542
0

hack the stack - using snort & ethereal to master the 8 layers of an insecure network

Ngày tải lên : 25/03/2014, 11:19

... Requests to be Authenticated A sample is compared with the user’s authentication request. 3. A Decision is Reached A match allows access, and a discrepancy denies access. The accuracy of a biometric ... look at the Data Link layer. Ethernet and the Data Link Layer The Data Link layer is divided into two sublayers: the MAC sublayer and the logical link control (LLC) sublayer .The MAC sublayer’s ... errors (False Acceptance Rate [FAR]) measure the percentage of individuals who gained access that shouldn’t have. When these two values are combined, the accuracy of the system is estab- lished.The...

468
729
0

the constants of nature from alpha to omega the numbers that encode the deepest secrets of the universe

Ngày tải lên : 06/07/2014, 15:31

367
294
0

the constants of nature from alpha to omega the numbers that encode the deepest secrets of the universe

Ngày tải lên : 06/07/2014, 15:34

367
309
0

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Ngày tải lên : 14/02/2014, 21:20

... for treatment of cancer pain a meta-analysis. Anesthesia and Analgesia 1995;80: 290-295. Hoskin PJ, Brada M. On behalf of the participants of the Second Workshop on Palliative Radiotherapy and ... awareness of the types of therapies that may be appropriate and increasing awareness of the role of the pain specialist in cancer pain management, which can lead to greater dialogue and liaison ... interventional and complementary therapies in cancer pain. It is directed at physicians and other healthcare professionals who treat pain from cancer at any stage of the disease with the hope of raising...

116
548
0

The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx

Ngày tải lên : 05/03/2014, 15:20

... status, and clinical variables such as cancer stage at diagnosis, time after diagnosis, and initial treatment. All measures will be collected at the beginning of the trial, and at 6, 12, 18 and ... possible for them to be blinded to the group assignment. The participants on the other handareunawareofthegroupassignment,astheyare under the assumption that the hospital is providing usual care. Intervention ... status) and hospitals (i.e., number of endometrial and ovarian cancer patien ts, whether a hospital is a training hospital) will be compared at baseline between the interv ention and usual care...

8
786
0

Cell Biology and Cancer under a contract from the National Institutes of Health doc

Ngày tải lên : 15/03/2014, 00:20

... by the discovery that bacteria cause a variety of important human diseases, was that cancer is an infectious disease. Another idea was that cancer arises from the chronic irritation of tissues. ... that many Americans remain unconvinced about the power of preven tion as a defense against cancer. Part of the reason may be that the only data we have about factors related to cancer are ... treat, and often, even cure cancer. A dramatic illustration of the success that scientists and health care specialists are having in the war against cancer came in the 1998 announcement by the...

164
578
0

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

Ngày tải lên : 16/03/2014, 23:20

... from the human trypsinogen prepro sequence was ampliﬁed from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted ... 7 (TACACACCCTGACCCGCATC) and 6 as template. Sequence analysis The sequence of the cDNA was analyzed using genetyx software (Software Development Co. Ltd, Tokyo, Japan). A novel serine protease ... cDNA was isolated from a human brain cDNA pool. Immuno- chemical and RT-PCR analyses revealed that prosemin is expressed in various kinds of cancer cell lines and in clinical samples of ovarian...

13
483
0

Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot

Ngày tải lên : 28/03/2014, 23:20

... 2007. Atención de la salud a través de las distintas épocas NiñezInfancia Neonatal Posnatal Embarazo Adolescencia Preembarazo Posparto Salud materna PARTO 21 Un balance sobre la mortalidad materna ASIA ... la familia. En cambio, una mejor salud materna puede reducir la pobreza (ODM 1), al ahorrar a la familia las desastrosas consecuencias económicas que acarrea su muerte o discapacidad. La asistencia ... desventajosa condición social, política y económica de la mujer en muchas sociedades. Las tasas más altas de mortalidad materna se registran en países de África subsahariana y Asia meridional Tasas...

48
417
0

A gene expression database for the molecular pharmacology of cancer pptx

Ngày tải lên : 30/03/2014, 13:20

... molecular consequences of therapy. This pharmacogenomic analysis is analogous to the assessment of molecular markers in the tumours of untreated patients. Analytical tools and data are available ... sharp boundary. Each block of red or blue may represent a causal correlation, an epiphenomenal association or a statistical artefact. Appropriate randomization studies can often rule out statistical artefact, ... alkylating agents, perhaps implying that drug metabolism rather than mechanism of action is an important feature of the activity-expression correlation. AT-matrix clustered image map The AT-clustered...

9
484
0

báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx

Ngày tải lên : 20/06/2014, 07:20

... favourable ovarian cancer survival. Clin Cancer Res 2003, 9:762-766. 32. Kayagaki N, Yamaguchi N, Nakayama M, Takeda K, Akiba H, Tsutsui H, Okamura H, Nakanishi K, Okumura K, Yagita H: Expression and ... article as: Lane et al.: The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer. Journal of Ovarian Research 2010 ... Activation of this path- way has been associated with cisplatin resistance in ovarian cancer [28]. In addition, the inhibition of Akt prevents the growth of ovarian cancer xenografts [29]. Thus, Akt...

10
383
0

báo cáo hóa học:" Endometriosis-associated ovarian cancer: A tenyear cohort study of women living in the Estrie Region of Quebec, Canada" doc

Ngày tải lên : 20/06/2014, 07:20

... to Ovarian Cancer Canada citing Statistics from the National Ovarian Cancer Survey: Perspectives of Canadian Women and Health Care Professionals (1999) [1]. Ovarian cancer (OC) affects about ... cause of cancer deaths. Six out of ten women di agno sed with ovarian cancer in Canada are 50 to 79 years of age [1]. The high mortality rate arises mainly because the disease is asymptomatic ... 70 Canadian women. About 23 00 new cases of ovarian cancer are found in women in Canada each year. About 1600 Canadian women die each year of this disease, mak- ing it the fifth r anking cause...