a c unit assembly removal and installation

iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

Ngày tải lên : 25/12/2013, 10:57

... C 466 are met 3.102.3 Cubicle switchgear and controlgear Metal-enclosed switchgear and controlgear, other than switchgear and controlgear COPYRIGHT 2002; International Electrotechnical Commission ... be taken into account for busbarsare those specified forcontacts, connections and' metal partsincontact with insulation, as the case may be The temperaturerise for accessible enclosures and covers ... controlgear (with - cubicle switchgear and controlgear one or more non-metal1ic.partition.s); 3.102.1 Metal-clad switchgear and controlgear Metal-enclosed switchgear and controlgear inwhich components...

139
465
0

unit 12: Films and Cinema. A-reading

Ngày tải lên : 30/07/2013, 01:25

... A Introduction  Can you name some films you have seen recently?  Giai Cuu Than Chet  3.Titanic sing 2.Kungfu Panda Owl and Sparrow Lord of the B Have a look at the two films, ... 13: Films and Cinema A - reading Unit 13: Films and Cinema Part A: Reading A New words  Sequence / 'si;kwJns / noun: a set of events, actions, numbers, etc  Set in 'motion: to start sth moving ... silent films and the spoken ones? Task 1: Find the word in the passage that can match the definition on right column  cinema   sequence series of related events or actions   decade a period...

14
835
7

Unit 8 Out and About A 1 -A 3

Ngày tải lên : 23/10/2013, 08:11

... is watching Tv Ask and answer What is he doing? He is reading book Ask and answer What is she doing? She is driving her car Ask and answer What are they doing? They are driving a car Ask and answer ... walking to school They are walking to school We are travelling to school by bus They are travelling to school by bus We are waiting for a train They are waiting for a train Ask and answer What is he ... They are walking to school start What are they doing? 10 They are traveling to school by bus start 10 What are they doing? They are waiting for a train Answer then write a. What are you doing? c. What...

46
477
0

Gián án UNIT 9 - LESSON A -C (G6) 2

Ngày tải lên : 24/11/2013, 10:11

... Listen and fill in the blank head and shoulders eyes and ears knees and toes and mouth and nose knees and toes head and shoulders head and shoulders 10 knees and toes knees and toes 11 knees and ... Listen and fill in the blank head and _ and ears knees and mouth and _and toes and shoulders head and 10 knees and _ _ and toes 11 knees and _ _ and toes ... 3-Chest 5-Hand 6-Arm 7-Leg 8-Foot 9-Toe Practice with a partner What is that? That is her head What are those? Those are her shoulders ? What is that? =What’s that? What are those? ? PRACTICE...

26
462
0

Bài soạn UNIT 9 - LESSON A-C (G6)

Ngày tải lên : 24/11/2013, 10:11

... face long hair Example: She He has a round face full lips a round face short hair Colors brown orange yellow blue white black red A B red white brown green blue yellow orange Practice Linsay ... Linsay Lohan is famous singer, actress She has ( a round /an oval) face She has ( long /short) hair She has (black/ brown /blue/green) eyes She has (thin/ full ) lips and small (yellow/black/ white ... A Head Chest 10 11 Leg 12 13 14 Body (n): thể, thânShoulder thể Head (n): đầu Neck (n): c Shoulder (n): vai Chest (n): ng c Arm Arm (n): c nh tay Hand (n): bàn tay Hand Finger (n): ngón tay...

12
517
0

Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Aﬀairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc

Ngày tải lên : 17/02/2014, 03:20

... a chance to inform us about it and treat mOTH as a parameter A 16 Banks report maturity and repricing data for securities and loans in 26 memoranda items on Call Report Schedules RC-B and RC -C, ... and Wang [1996], and Gomes et al [2003] More recently, Avramov and Chordia [2006] show that allowing betas to vary with ﬁrm characteristics and macroeconomic variables, the conditional CAPM can ... Imperfect Financial Markets: The Case of Retail Bank Deposits,” Journal of Financial and Quantitative Analysis, 31, 399–417 Jagannathan, R and Z Wang (1996): “The Conditional CAPM and the Cross Section...

47
528
1

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... these cells may cause a dysfunctional cardiac ﬂow and cause the sudden death of the transgenic mice, although it remains to be determined whether T antigen-expressing cardiac valves are functionally ... physiological functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis...

11
873
0

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Ngày tải lên : 21/02/2014, 01:21

... Bobik, A & Campbell, J.H (1993) Vascular derived growth factors: cell biology, pathophysiology, and pharmacology Pharmacol Rev 45, 1–42 41 Vacca, A. , Bruno, M., Boccarelli, A. , Coluccia, M., Ribatti, ... ERK and JNK mitogen-activated protein kinase cascades to Ras transformation of HT1080 ﬁbrosarcoma and DLD-1 colon carcinoma cells Oncogene 18, 1807–1817 Oka, H., Chatani, Y., Hoshino, R., Ogawa, ... each primer pairs by using 0.5 lCi of [a- 32P]dCTP (speci c activity 3000 CiÆmmol)1, Amersham Pharmacia Biotech) and establishing the point at which exponential accumulation plateaus Using 30 PCR...

10
703
0

Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

Ngày tải lên : 21/02/2014, 12:20

... mission, values, political and social climate, and quality (e.g., national or regional ranking) The department’s mission, research activities, curriculum, and collegial atmosphere The parameters and ... understandings in place that allow the faculty to appropriately carry out activities, from teaching to research to the provision of clinical care Key academic health center officials include the ... university and often also oversees diverse functions such as facilities planning and construction, human resources, and campus services (e.g., parking, public safety, maintenance, and mail service) Vice...

267
616
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Ngày tải lên : 06/03/2014, 01:20

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... http://www.nap.edu/catalog/12793.html ACRONYMS AND ABBREVIATIONS AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC CDC CHIP CI CIA CMS DIS DTaP DUIT DVH EIA EIP EPSDT FDA FEHBP FQHC HAV ... state and local health departments to conduct standard disease surveillance on newly diagnosed acute and chronic HBV and HCV infections, and targeted surveillance to obtain data on specific populations...

191
457
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Ngày tải lên : 06/03/2014, 01:20

... variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower ... B surface antibody Hepatitis C antibody Asian and Pacific Islander aspartate transaminase adult viral hepatitis prevention coordinators CDC CHIP CI CIA CMS Centers for Disease Control and Prevention ... http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases Advisory Committee on Immunization Practices...

253
369
0

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Ngày tải lên : 06/03/2014, 11:20

... peach (Prunus persica L Cv Catherina) Molecular properties and kinetic characterization of soluble and membrane-bound forms J Agric Food Chem 55, 10446–10451 31 Gandia-Herrero F, Garcia-Carmona ... compartmentalized cell plan with members of bacterial phylum Planctomycetes BMC Microbiol 9, 20 Plonka PM & Grabacka M (2006) Melanin synthesis in microorganisms-biotechnological and medical aspects Acta ... temperature and A5 46 was measured, using water as a reference A standard curve using 0–165 lm CuCl2Æ2H2O was also made and gave a calculated e for the copper biquinoline complex of 5982 m)1Æcm)1 Trypsinization...

13
778
0

Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-speciﬁc intronic inverted repeats pptx

Ngày tải lên : 07/03/2014, 00:20

... Molecular transdducer activity Signal transduction Plasma membrane Membrane part Cell communication Multicellular organismal process Synapse Transmembrane receptor activity Intrinsic to membrane ... Substrate-speci c transporter Neuron projection GTPase activator activity Inorganic anion transport Biological regulation Rho guanyl-nucleotide exchange factor Ras guanyl-nucleotide exchange factor Cytoskeleton ... Biol Chem 280, 32700–32711 Baraniak AP, Lasda EL, Wagner EJ & Garcia-Blanco MA (2003) A stem structure in ﬁbroblast growth factor receptor transcripts mediates cell-type-speci c splicing by approximating...

13
542
0

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Ngày tải lên : 07/03/2014, 05:20

... PCR ampliﬁcation of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L -C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... Lim15/Dmc1 and the CAF-1–PCNA complex A S Ishii et al C D B Fig Molecular cloning of CcCac1L and its interaction with CcLim15 (A) Schematic diagram of the CAF-1 large subunits in human, C cinerea and ... 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG To overexpress N-terminal hexahistidine-tagged CcCac1L-N (His-CcCac1L-N) and CcCac1L -C (His-CcCac1L -C) , E coli BL21 cells (DE3) (Novagen) carrying the expression plasmid for each...

10
487
0

International consensus recommendations on the aesthetic usage of botulinum toxin type A (Speywood Unit) – part II: wrinkles on the middle and lower face, neck and chest pdf

Ngày tải lên : 07/03/2014, 17:20

... treatment in ´ ´ the decollete area Anatomy The major muscles in the chest area are the caudal part of the platysma and the medial ﬁbres of the pectoralis major The injector can palpate the muscles ... (Speywood Unit) , and can be further adapted in clinical practice to meet individual needs Safety concerns Although dysphagia, dysphonia and neck References weakness were listed as potential serious adverse ... mouth corners (a) and dimpled chin (b) (Graph was modiﬁed from de Maio and Rzany19) (c) Photographs of a patient at maximal contraction before and 21 days after the treatment with 20 s.U of BoNT-A...

11
772
1

Báo cáo khoa học: Relation between domain evolution, speciﬁcity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Ngày tải lên : 08/03/2014, 08:20

... Psesa Psest Psesp Bacst Actsp Bac11 Bac17 Bac38 Bac663 Bac1011 BacA2 Bac1018 BacE1 BacKC Bacbr Bacci8 Bacci251 BacciA Baccl Bacli BacmaIB7 BacIFO Bacoh Bacst1 Bacst2 Klepn Nossp Thbsp Thbth Thcsp ... Reference withdrawn Takada, M., Nakagawa, Y & Yamamoto, M (2003) Biochemical and genetic analyses of a novel c- cyclodextrin glucanotransferase from an alkalophilic Bacillus clarkii 7364 J Biochem ... pneumoniae CGT Nostoc sp PCC 9229 CGT Thermococcus sp B1001 CGT Actinoplanes sp SE50 ACT Bacillus stearothermophilus MAA Aspergillus kawachii AAM Bacillus sp TS-23 AAM Streptomyces griseus AAM Pseudomonas...

11
615
0

Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence speciﬁc DNA binding proteins pptx

Ngày tải lên : 08/03/2014, 08:20

... H-strand encoded RNAs by cDNA sequencing, has revealed that the putative polyadenylation signal, AAUAAA, is conserved in human, mouse and rat mt genomes [20] A dodecamer sequence AAUAA(U /C) AUUCUU ... residue at 16 295 of the genome The 22-bp nucleotide sequence (16 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination ... its ﬂanking sequences (16274-5¢-ATTACGCAATAAACATTAACAA-3¢-16295¢) binds to mt-speci c proteins, different from the previously characterized 36-kDa mTERF [17], and terminates transcription in an...

13
415
0

Báo cáo khoa học: a-Fetoprotein positively regulates cytochrome c-mediated caspase activation and apoptosome complex formation docx

Ngày tải lên : 08/03/2014, 08:20

... cyt -c cannot directly induce caspase activation in a cell-free system in the absence of procaspase AFP cannot induce activation of procaspase in the absence of caspase As AFP was unable to activate ... endogenous cyt -c, procaspase 3, or procaspase Caspase activation was then induced by the addition of cyt -c/ dATP with or without AFP AFP was unable to induce caspase activation in the absence of cyt -c and/ or ... and caspases and 3, we precipitated pure recombinant active caspases and (His-tagged) with nickel resin and then incubated them with AFP and S-100 extract, as a source of cIAP-2 A similar reaction...

12
401
0

Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot

Ngày tải lên : 17/03/2014, 17:20

... and a b-amino group of lysine Other b-amino acids such as b-alanine or b-aminobutyric acid, c- aminobutyric acid and e-amino caproic acid were not activated Thus, the activating enzyme appears to ... pooled and concentrated in a microconcentrator (Centricon 30, Amicon) Concentrated enzyme was subjected to gel ®ltration chromatography (Superose 12 HR 10/30 column, Pharmacia) using a Smart chromatography ... step, see Materials and methods) was incubated with NpsA, radioactive b-lysine and ATP The reaction mixtures were incubated at 28 C for 30 mL 5% trichloroacetic acid was added and precipitated protein...

11
559
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Ngày tải lên : 22/03/2014, 17:20

... program coordinators to expand and enhance the capacity to identify chronically infected pregnant women and provide case-management services, including referral for appropriate medical management ... chronic hepatitis B and hepatitis C, and conduct targeted active surveillance to monitor incidence and prevalence of hepatitis B and hepatitis C in populations not fully captured by core surveillance ... stable and washed School-entry mandates have been shown to increase hepatitis B vaccination rates and to reduce disparities in vaccination rates Therefore, the committee recommends that all states...

4
404
1