... definition workable, we will need to recall basic facts about cohomology of line bundles on abelian varieties See corollary 2.2.4 in the next paragraph 2.2 Cohomology of line bundles on abelian varieties ... 3.1.3 An abelian variety is called simple if it does not admit strict abelian subvariety Proposition 3.1.4 If X is a < /b> simple abelian variety, EndQ (X) is a < /b> division algebra Proof Let f : X → X be a < /b> ... into a < /b> projective space (2) A < /b> polarization of an abelian variety X = V /U is an alternating form λ : U → Z which is the Chern class of an ample line bundle With a < /b> suitable choice of a < /b> basis of...
Ngày tải lên: 05/10/2014, 12:44
... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons...
Ngày tải lên: 05/11/2012, 09:18
Azar b s , hagen s a understanding and using english grammar students'' book 2009
Ngày tải lên: 28/11/2013, 21:14
Azar b s , hagen s a understanding and using english grammar workbook 2009
Ngày tải lên: 28/11/2013, 21:19
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... serum albumin) was better at a < /b> near-neutral pH (at pH 6.0, there was no detectable loss of activity under the conditions described below; A < /b> C Bunổs and < /b> G Vaaje-Kolstad, unpublished observations) ... Costs and < /b> benets of processivity in enzymatic degradation of recalcitrant polysaccharides Proc Natl Acad Sci USA 103, 1808918094 41 Tsujibo H, Orikoshi H, Baba N, Miyahara M, Miyamoto K, Yasuda M...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... a < /b> high-resolution solution structure of the C-terminal a-< /b> domain has become available The data revealed a < /b> tertiary fold very similar to that of MT-1 and < /b> MT-2, except for a < /b> loop that contains an ... Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys (NH) Lys (a)< /b> ...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khóa học: Conformational changes of b-lactoglobulin in sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A fluorescence and CD study docx
... peptide bond absorption band causing no changes in the far-UV CD spectra So, the broad band centred at 270 nm obtained in bLG CD spectra upon encapsulation on AOT RM may arise from the changes in nature ... basis Data analysis was performed by a < /b> deconvolution method using a < /b> nonlinear least-squares fit programme, based on the Marquardt algorithm The goodness of fit was evaluated by statistical parameters ... preparation Bovine bLG (AB < /b> mixture), chromatographically purified and < /b> lyophilized to ‡ 90% purity (Sigma; catalogue no L-3908), N-acetyltryptophanamide (NATA) (Sigma; catalogue no A-< /b> 6501) and < /b> AOT...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn ... gland, caudate nucleus, temporal lobe, hippocampus, and < /b> fetal tissues (brain, kidney, thymus, liver), and < /b> rather weakly in placenta, lung, aorta, amygdala, occipital and < /b> parietal lobe and < /b> salivary ... specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a < /b> HpaI site and < /b> Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and < /b> subcloned into pUC19 for further...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... protein matrix of the triliganded HbA (Table 1, ), but only one in every 20 ligands leaves the a < /b> subunits (Table 1, ), and < /b> in every six ligands leaves the b subunits (Table 1, ) Using ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot
... gambiae (ENSAN1_ANGA, XP_312118.1), (ENSAN5_ANGA, XP_312116.1) and < /b> (BACBP_ANGA, CAA04496.1), as well as the GLUBP from the lobster Homarus gammarus (GLUBP_HOGAM, CAE47485.1) and < /b> the crayfish Pacifastacus ... thio -b- Dgalactoside, the bacterial extract was isolated and < /b> purified by affinity chromatography (Fig 8A;< /b> lanes a < /b> and < /b> b) The 68 kDa recombinant fusion protein (r-EGF_SUBDO) was used to raise PoAbs, as described in ... epithelial layer formed from pinacocytes Magnifications: A-< /b> a and < /b> B -a,< /b> · 25; A-< /b> b and < /b> B- b, · 50; A-< /b> c and < /b> B- c, · 100 PoAb-EGF precursor, which corresponded to a < /b> molecular weight of kDa This molecular...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt
... wild-type and < /b> R120G aB-< /b> crystallin Chaperone ability and < /b> stability to urea of R120G aB-< /b> crystallin Fig Degradation of R120G aB-< /b> crystallin with time at room temperature (A)< /b> Transformed mass spectrum ... R120G aB-< /b> crystallin and < /b> a-< /b> lactalbumin contained both proteins (not shown), as found previously by Bova et al [22] implying that R120G aB-< /b> crystallin bound to reduced a-< /b> lactalbumin and < /b> the resultant ... & Robbins J (2001) Expression of R120G -aB-< /b> crystallin causes aberrant desmin and < /b> aB-< /b> crystallin aggregation and < /b> cardiomyopathy in mice Circ Res 89, 84–91 Chavez Zobel AT, Loranger A,< /b> Marceau N,...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc
... probably acts as a < /b> backbone H-bond donor to Asn316 Mutation of Lys319 to a < /b> proline would remove this H-bond and < /b> probably be disruptive for the geometry of the turn Lys319 approaches with ˚ 4.5 A < /b> ... The patient’s muscle homogenate demonstrated a < /b> remarkable loss of complex I and < /b> complex III subunits, but normal steady-state levels of complexes II, IV and < /b> V subunits (B) BN-PAGE and < /b> in-gel activity ... structural change at the Qo site, which would have explained the change in KM Additionally, it appeared that the overall stability of mutant bc1 complex in crude membrane preparations was not noticeably...
Ngày tải lên: 16/03/2014, 22:20
The a and b adapters are used as priming sites for both amplification
... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...
Ngày tải lên: 19/03/2014, 22:32
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx
... flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions at 267 nm Average values and < /b> standard ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron ... except Arabidopsis thaliana and < /b> Arabidopsis arenosa Thus, linolipins constitute a < /b> second family of oxylipin-esterified galactolipids along with the arabidopsides Moreover, flax is the second plant...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... described Fig (A)< /b> The relative strengths of Hsp9 0a-< /b> BD–AD-Slt2p, Hsp90bBD–AD-Slt2p, Hsp9 0a-< /b> BD–AD-ERK5 and < /b> Hsp9 0b- BD–AD–ERK5 Y2H interactions, both at 30 °C and < /b> h following a < /b> 30 °C to 39 °C heat shock...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt
... water for each Partial acetylation of serines and < /b> threonines was avoided by adding 12 lL of a < /b> solution containing 0.5 mm hydroxylamine and < /b> 100 mm NaOH to the reaction chamber and < /b> incubating at ... pathway for light-dependent chlorophyll biosynthesis in Arabidopsis thaliana Plant Physiol 108, 1505–1517 Oosawa N, Masuda T, Awai K, Fusada N, Shimada H, Ohta H & Takamiya K (2000) Identification ... and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc
... accumulation of fat mass remains to be determined Available epidemiological data addressing the implication of PAH, in general, as a < /b> causal factor in the pathogeny of metabolic disorders are currently ... Tremblay A < /b> & Doucet E (2000) Obesity: a < /b> disease or a < /b> biological adaptation? Obes Rev 1, 27–35 47 Binkova B, Smerhovsky Z, Strejc P, Boubelik O, Stavkova Z, Chvatalova I & Sram RJ (2002) DNA-adducts ... increased fat mass, as indicated by results of body composition analysis Our interpretation of these data is that chronic inhibition by B [a]< /b> P of physiological b- adrenergic and < /b> ACTH stimulation caused...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... sequences available in the NCBI database The programs used are all available from http://www.infobiogen.fr Chromosome localization The Abo gene was first assigned to a < /b> rat chromosome using a < /b> panel ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland,...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... antagonism on prostaglandin and < /b> leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, ... 45 by up-regulating the synthesis and < /b> release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A < /b> & Bresnahan, B .A < /b> (1999) Effect of thromboxane A2< /b> inhibition and < /b> ... PROCEDURES Materials UltraspecTM total RNA isolation system was obtained from Biotecx Laboratories, Houston, TX, USA Perfectly Blunt Cloning kit, and < /b> Pellet-paint coprecipitant, was obtained from Calbiochem-Novabiochem,...
Ngày tải lên: 31/03/2014, 09:20
transport phenomena and unit operations a combined approach
... in atmospheres, DAB = ? ( o A < /b> + o B ) , C A < /b> B = and < /b> RDAB a < /b> function of K T / e A < /b> B( see Appendix B, Table A-< /b> 3-4) is m, Example 1-1 The viscosity of isobutane at 23°C and < /b> atmospheric pressure pascal-sec ... of scale-up The use of this approach has enabled large-scale operations to be logically and < /b> effectively generated from laboratory-scale experiments The philosophy of scale-up was probably best ... manner As can be seen from the shapes of the curves in Figure 2-8, there is a < /b> considerable difference between laminar and < /b> turbulent flow The shape of the former is a < /b> true parabola This parabolic...
Ngày tải lên: 02/04/2014, 16:46